Morpholino

MO3-sulf1

ID
ZDB-MRPHLNO-140321-1
Name
MO3-sulf1
Previous Names
  • S1-ATG (1)
Target
Sequence
5' - CACCAGCTGCATCATGGGACTGCGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sulf1
Expressed Gene Anatomy Figures
angpt1 Fig. S8 from Gorsi et al., 2014
dab2 Fig. 6 from Gorsi et al., 2014
dlc Fig. 6 from Gorsi et al., 2014
efnb2a Fig. 6 from Gorsi et al., 2014
flt4 Fig. 6 from Gorsi et al., 2014
kdrl Fig. 6 from Gorsi et al., 2014
notch3 Fig. 6 from Gorsi et al., 2014
stab2 Fig. 6 from Gorsi et al., 2014
vegfaa Fig. S8 from Gorsi et al., 2014
Phenotype
Phenotype resulting from MO3-sulf1
Phenotype Fish Figures
axial vasculature blood circulation disrupted, abnormal WT + MO3-sulf1 Fig. 4 from Gorsi et al., 2014
blood accumulation caudal vein plexus, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S5 from Gorsi et al., 2014
blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S3 from Gorsi et al., 2014
blood vessel lumenization disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 5 from Gorsi et al., 2014
caudal artery immature, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 5 from Gorsi et al., 2014
caudal artery morphology, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 5 from Gorsi et al., 2014
caudal vein plexus disorganized, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 5 from Gorsi et al., 2014
central artery immature, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S3 from Gorsi et al., 2014
central artery blood vessel lumenization disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 5 from Gorsi et al., 2014
cranial vasculature broken, abnormal s844Tg + MO3-sulf1 Fig. S6 from Gorsi et al., 2014
cranial vasculature lacks parts or has fewer parts of type central artery, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S3,  Fig. S5 from Gorsi et al., 2014
cranial vasculature blood circulation disrupted, abnormal WT + MO3-sulf1 Fig. 3,  Fig. 4,  Fig. S5 from Gorsi et al., 2014
dorsal aorta blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S5 from Gorsi et al., 2014
head hemorrhagic, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 1,  Fig. S3 from Gorsi et al., 2014
heparan sulfate 6-O-sulfotransferase activity process quality, abnormal WT + MO3-sulf1 Fig. 2 from Gorsi et al., 2014
hindbrain edematous, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S3 from Gorsi et al., 2014
hindbrain morphology, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 1 from Gorsi et al., 2014
post-vent region edematous, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. 1 from Gorsi et al., 2014
post-vent vasculature blood circulation disrupted, abnormal sd2Tg + MO3-sulf1 Fig. 3 from Gorsi et al., 2014
spinal cord curved, abnormal s844Tg; sd2Tg + MO3-sulf1 Fig. S3 from Gorsi et al., 2014
Phenotype of all Fish created by or utilizing MO3-sulf1
Phenotype Fish Conditions Figures
axial vasculature blood circulation disrupted, abnormal WT + MO3-sulf1 standard conditions Fig. 4 from Gorsi et al., 2014
heparan sulfate 6-O-sulfotransferase activity process quality, abnormal WT + MO3-sulf1 standard conditions Fig. 2 from Gorsi et al., 2014
cranial vasculature blood circulation disrupted, abnormal WT + MO3-sulf1 standard conditions Fig. 4 from Gorsi et al., 2014
cranial vasculature broken, abnormal s844Tg + MO3-sulf1 standard conditions Fig. S6 from Gorsi et al., 2014
post-vent vasculature blood circulation disrupted, abnormal sd2Tg + MO3-sulf1 standard conditions Fig. 3 from Gorsi et al., 2014
cranial vasculature blood circulation disrupted, abnormal sd2Tg + MO3-sulf1 standard conditions Fig. 3,  Fig. S5 from Gorsi et al., 2014
head hemorrhagic, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 1,  Fig. S3 from Gorsi et al., 2014
blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S3 from Gorsi et al., 2014
dorsal aorta blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S5 from Gorsi et al., 2014
blood accumulation caudal vein plexus, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S5 from Gorsi et al., 2014
blood vessel lumenization disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 5 from Gorsi et al., 2014
hindbrain edematous, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S3 from Gorsi et al., 2014
caudal vein plexus disorganized, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 5 from Gorsi et al., 2014
cranial vasculature lacks parts or has fewer parts of type central artery, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S3,  Fig. S5 from Gorsi et al., 2014
caudal artery morphology, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 5 from Gorsi et al., 2014
post-vent region edematous, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 1 from Gorsi et al., 2014
caudal artery immature, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 5 from Gorsi et al., 2014
hindbrain morphology, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 1 from Gorsi et al., 2014
cranial vasculature blood circulation disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S5 from Gorsi et al., 2014
spinal cord curved, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S3 from Gorsi et al., 2014
central artery immature, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. S3 from Gorsi et al., 2014
central artery blood vessel lumenization disrupted, abnormal s844Tg; sd2Tg + MO3-sulf1 standard conditions Fig. 5 from Gorsi et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.