Morpholino
MO1-nfe2l1b
- ID
- ZDB-MRPHLNO-140225-2
- Name
- MO1-nfe2l1b
- Previous Names
- None
- Target
- Sequence
-
5' - AATCACGCAAACAAACGTCAAACCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nfe2l1b
No data available
Phenotype
Phenotype resulting from MO1-nfe2l1b
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-nfe2l1b
1 - 5 of 6 Show all
Citations
- Sant, K.E., Moreau, H.M., Williams, L.M., Jacobs, H.M., Bowsher, A.M., Boisvert, J.D., Smolowitz, R.M., Pantazis, J., Annunziato, K., Nguyen, M., Timme-Laragy, A. (2020) Embryonic exposures to mono-2-ethylhexyl phthalate induce larval steatosis in zebrafish independent of Nrf2a signaling. Journal of developmental origins of health and disease. 12(1):132-140
- Mukaigasa, K., Tsujita, T., Nguyen, V.T., Li, L., Yagi, H., Fuse, Y., Nakajima-Takagi, Y., Kato, K., Yamamoto, M., Kobayashi, M. (2018) Nrf2 activation attenuates genetic endoplasmic reticulum stress induced by a mutation in the phosphomannomutase 2 gene in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 115(11):2758-2763
- Sant, K.E., Hansen, J.M., Williams, L.M., Tran, N.L., Goldstone, J.V., Stegeman, J.J., Hahn, M.E., Timme-Laragy, A. (2017) The role of Nrf1 and Nrf2 in the regulation of glutathione and redox dynamics in the developing zebrafish embryo. Redox Biology. 13:207-218
- Williams, L.M., Timme-Laragy, A.R., Goldstone, J.V., McArthur, A.G., Stegeman, J.J., Smolowitz, R.M., and Hahn, M.E. (2013) Developmental expression of the Nfe2-related factor (Nrf) transcription factor family in the zebrafish, Danio rerio. PLoS One. 8(10):e79574
1 - 4 of 4
Show