Morpholino

MO3-matn1

ID
ZDB-MRPHLNO-140218-1
Name
MO3-matn1
Previous Names
  • Matn-1z SP antisense (1)
Target
Sequence
5' - GGATGTGTGAATGTCTTACCCATAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-matn1
Expressed Gene Anatomy Figures
matn1 Fig. 4Fig. 5 from Neacsu et al., 2014
Phenotype
Phenotype resulting from MO3-matn1
Phenotype Fish Figures
cartilage development decreased process quality, abnormal WT + MO3-matn1 Fig. 3 from Neacsu et al., 2014
caudal fin curved, abnormal WT + MO3-matn1 + MO4-tp53 Fig. 3 from Neacsu et al., 2014
caudal fin deformed, abnormal WT + MO3-matn1 Fig. 3 from Neacsu et al., 2014
chondrocranium cartilage cartilage element immature, abnormal WT + MO3-matn1 Fig. 3 from Neacsu et al., 2014
chondrocyte endoplasmic reticulum disorganized, abnormal WT + MO3-matn1 Fig. 6 from Neacsu et al., 2014
chondrocyte endoplasmic reticulum increased size, abnormal WT + MO3-matn1 Fig. 6 from Neacsu et al., 2014
chondrocyte endoplasmic reticulum lumen distended, abnormal WT + MO3-matn1 Fig. 6 from Neacsu et al., 2014
extension shortened, abnormal WT + MO3-matn1 + MO4-tp53 Fig. 3 from Neacsu et al., 2014
eye decreased pigmentation, abnormal WT + MO3-matn1 Fig. 3 from Neacsu et al., 2014
eye apoptotic DNA fragmentation increased process quality, abnormal WT + MO3-matn1 Fig. 10 from Neacsu et al., 2014
head malformed, abnormal WT + MO3-matn1 + MO4-tp53 Fig. 3 from Neacsu et al., 2014
integument detached from whole organism, abnormal WT + MO3-matn1 Fig. 9 from Neacsu et al., 2014
pharyngeal arch cartilage element immature, abnormal WT + MO3-matn1 Fig. 3 from Neacsu et al., 2014
somite border deformed, abnormal WT + MO3-matn1 Fig. 3 from Neacsu et al., 2014
spinal cord apoptotic DNA fragmentation increased process quality, abnormal WT + MO3-matn1 Fig. 10 from Neacsu et al., 2014
trunk curved, abnormal WT + MO3-matn1 + MO4-tp53 Fig. 3 from Neacsu et al., 2014
whole organism decreased pigmentation, abnormal WT + MO3-matn1 Fig. 3 from Neacsu et al., 2014
whole organism decreased size, abnormal WT + MO3-matn1 + MO4-tp53 Fig. 3 from Neacsu et al., 2014
Phenotype of all Fish created by or utilizing MO3-matn1
Phenotype Fish Conditions Figures
caudal fin deformed, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
eye apoptotic DNA fragmentation increased process quality, abnormal WT + MO3-matn1 standard conditions Fig. 10 from Neacsu et al., 2014
trunk curved, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
somite border deformed, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
chondrocyte endoplasmic reticulum disorganized, abnormal WT + MO3-matn1 standard conditions Fig. 6 from Neacsu et al., 2014
cartilage development decreased process quality, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
spinal cord apoptotic DNA fragmentation increased process quality, abnormal WT + MO3-matn1 standard conditions Fig. 10 from Neacsu et al., 2014
whole organism decreased pigmentation, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
whole organism decreased size, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
head malformed, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
caudal fin curved, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
chondrocyte endoplasmic reticulum lumen distended, abnormal WT + MO3-matn1 standard conditions Fig. 6 from Neacsu et al., 2014
extension shortened, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
pharyngeal arch cartilage element immature, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
integument detached from whole organism, abnormal WT + MO3-matn1 standard conditions Fig. 9 from Neacsu et al., 2014
chondrocranium cartilage cartilage element immature, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
chondrocyte endoplasmic reticulum increased size, abnormal WT + MO3-matn1 standard conditions Fig. 6 from Neacsu et al., 2014
eye decreased pigmentation, abnormal WT + MO3-matn1 standard conditions Fig. 3 from Neacsu et al., 2014
caudal fin deformed, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
caudal fin curved, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
extension shortened, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
whole organism decreased size, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
trunk curved, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
head malformed, abnormal WT + MO3-matn1 + MO4-tp53 standard conditions Fig. 3 from Neacsu et al., 2014
Citations