Morpholino
MO3-esr1
- ID
- ZDB-MRPHLNO-131203-1
- Name
- MO3-esr1
- Previous Names
-
- Exon 3 Intron 3 (1)
- Target
- Sequence
-
5' - CATGTAAAACAGGCTGGTCACCTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-esr1
No data available
Phenotype
Phenotype resulting from MO3-esr1
No data available
Phenotype of all Fish created by or utilizing MO3-esr1
No data available
Citations
- Wesselman, H.M., Gatz, A.E., Pfaff, M.R., Arceri, L., Wingert, R.A. (2023) Estrogen Signaling Influences Nephron Segmentation of the Zebrafish Embryonic Kidney. Cells. 12(4):
- Li, X., Wang, L., Qin, X., Chen, X., Li, L., Huang, Z., Zhang, W., Liu, W. (2022) Estrogens revert neutrophil hyperplasia by inhibiting Hif1α-cMyb pathway in zebrafish myelodysplastic syndromes models. Cell death discovery. 8:323
- Bugel, S.M., Wehmas, L.C., La Du, J.K., Tanguay, R.L. (2016) Phenotype anchoring in zebrafish reveals a potential role for matrix metalloproteinases (MMPs) in tamoxifen's effects on skin epithelium. Toxicology and applied pharmacology. 296:31-41
- Cott, K.A., Nacci, D., Champlin, D., Yeo, A.T., Gilmore, T.D., Callard, G.V. (2016) Adaptive significance of ERα splice variants in killifish (Fundulus heteroclitus) resident in an estrogenic environment. Endocrinology. 157(6):2294-308
- Griffin, L.B., January, K.E., Ho, K.W., Cotter, K.A., and Callard, G.V. (2013) Morpholino Mediated Knockdown of ERalpha, ERbetaa and ERbetab mRNAs in Zebrafish (Danio rerio) Embryos Reveals Differential Regulation of Estrogen-Inducible Genes. Endocrinology. 154(11):4158-69
1 - 5 of 5
Show