Morpholino

MO1-cdk10

ID
ZDB-MRPHLNO-131126-4
Name
MO1-cdk10
Previous Names
None
Target
Sequence
5' - GGTCTGTGTCTGCTGTGCTCTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdk10
No data available
Phenotype
Phenotype resulting from MO1-cdk10
Phenotype Fish Figures
brain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 5 from Yeh et al., 2013
brain decreased size, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 4 from Yeh et al., 2013
brain branching morphogenesis of a nerve decreased occurrence, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 7 from Yeh et al., 2013
eye decreased size, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 4 from Yeh et al., 2013
forebrain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 5 from Yeh et al., 2013
hindbrain morphology, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 4 from Yeh et al., 2013
hindbrain neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 7,  Fig. 8 from Yeh et al., 2013
midbrain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 5 from Yeh et al., 2013
midbrain morphology, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 4 from Yeh et al., 2013
midbrain hindbrain boundary amorphous, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 4 from Yeh et al., 2013
motor neuron axon decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 7 from Yeh et al., 2013
neural plate dorsal region apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 5 from Yeh et al., 2013
neural tube neuron decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 Fig. 8 from Yeh et al., 2013
neurogenesis disrupted, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 7,  Fig. 11 from Yeh et al., 2013
neuronal stem cell apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 11 from Yeh et al., 2013
olfactory bulb disorganized, abnormal as8Tg + MO1-cdk10 + MO4-tp53 Fig. 8 from Yeh et al., 2013
optic tectum neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 7,  Fig. 8 from Yeh et al., 2013
retinal ganglion cell decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 Fig. 8 from Yeh et al., 2013
Rohon-Beard neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 6,  Fig. 7 from Yeh et al., 2013
somite morphology, abnormal WT + MO1-cdk10 + MO4-tp53 Fig. 4 from Yeh et al., 2013
telencephalon disorganized, abnormal as8Tg + MO1-cdk10 + MO4-tp53 Fig. 8 from Yeh et al., 2013
telencephalon neuron decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 Fig. 8 from Yeh et al., 2013
Phenotype of all Fish created by or utilizing MO1-cdk10
Phenotype Fish Conditions Figures
forebrain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
brain branching morphogenesis of a nerve decreased occurrence, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
hindbrain morphology, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
midbrain hindbrain boundary amorphous, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
somite morphology, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
hindbrain neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
neural plate dorsal region apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
brain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
neurogenesis disrupted, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7,  Fig. 11 from Yeh et al., 2013
midbrain apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 5 from Yeh et al., 2013
motor neuron axon decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
midbrain morphology, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
Rohon-Beard neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 6,  Fig. 7 from Yeh et al., 2013
brain decreased size, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
eye decreased size, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 4 from Yeh et al., 2013
neuronal stem cell apoptotic, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 11 from Yeh et al., 2013
optic tectum neuron decreased amount, abnormal WT + MO1-cdk10 + MO4-tp53 standard conditions Fig. 7 from Yeh et al., 2013
optic tectum neuron decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
telencephalon disorganized, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
neural tube neuron decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
telencephalon neuron decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
retinal ganglion cell decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
hindbrain neuron decreased amount, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
olfactory bulb disorganized, abnormal as8Tg + MO1-cdk10 + MO4-tp53 standard conditions Fig. 8 from Yeh et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.