Morpholino
MO3-dnaaf4
- ID
- ZDB-MRPHLNO-131029-3
- Name
- MO3-dnaaf4
- Previous Names
-
- MO3-dyx1c1
- dyx1c1 AUG-MO (1)
- Target
- Sequence
-
5' - TGTGATCTCTTACTATCAGCGGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dnaaf4
No data available
Phenotype
Phenotype resulting from MO3-dnaaf4
Phenotype | Fish | Figures |
---|---|---|
post-vent region curved ventral, abnormal | WT + MO3-dnaaf4 |
Fig. S5
from Grimes et al., 2016 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO3-dnaaf4
1 - 5 of 8 Show all
Citations
- Grimes, D.T., Boswell, C.W., Morante, N.F., Henkelman, R.M., Burdine, R.D., Ciruna, B. (2016) Zebrafish models of idiopathic scoliosis link cerebrospinal fluid flow defects to spine curvature. Science (New York, N.Y.). 352:1341-4
- Tarkar, A., Loges, N.T., Slagle, C.E., Francis, R., Dougherty, G.W., Tamayo, J.V., Shook, B., Cantino, M., Schwartz, D., Jahnke, C., Olbrich, H., Werner, C., Raidt, J., Pennekamp, P., Abouhamed, M., Hjeij, R., Köhler, G., Griese, M., Li, Y., Lemke, K., Klena, N., Liu, X., Gabriel, G., Tobita, K., Jaspers, M., Morgan, L.C., Shapiro, A.J., Letteboer, S.J., Mans, D.A., Carson, J.L., Leigh, M.W., Wolf, W.E., Chen, S., Lucas, J.S., Onoufriadis, A., Plagnol, V., Schmidts, M., Boldt, K., UK10K., Roepman, R., Zariwala, M.A., Lo, C.W., Mitchison, H.M., Knowles, M.R., Burdine, R.D., Loturco, J.J., and Omran, H. (2013) DYX1C1 is required for axonemal dynein assembly and ciliary motility. Nature Genetics. 45(9):995-1003
1 - 2 of 2
Show