ZFIN ID: ZDB-MRPHLNO-130930-1
Morpholino Name: MO2-adora2aa
Target: adora2aa (1)
Sequence:
5' - AGAAACACCCTTCACTCACCTAAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-adora2aa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-adora2aa No data available
PHENOTYPE
Phenotype resulting from MO2-adora2aa
No data available

Phenotype of all Fish created by or utilizing MO2-adora2aa
Phenotype Fish Conditions Figures
pancreas has fewer parts of type pancreatic B cell, abnormal s892Tg; zf5Tg + MO2-adora2aa chemical treatment: drug Fig. 5 with image from Andersson et al., 2012
pancreas has fewer parts of type pancreatic B cell, abnormal s892Tg; zf5Tg + MO2-adora2aa chemical treatment: pharmaceutical Fig. 5 with image from Andersson et al., 2012
OTHER MO2-adora2aa MORPHOLINO PAGESNo links to external sites
CITATIONS (1)