Morpholino

MO2-mtmr12

ID
ZDB-MRPHLNO-130910-8
Name
MO2-mtmr12
Previous Names
  • exon3-intron3 (1)
Target
Sequence
5' - GCCCGGTCAACTGTCCTTACCATCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mtmr12
No data available
Phenotype
Phenotype resulting from MO2-mtmr12
Phenotype Fish Figures
hatching decreased occurrence, abnormal AB + MO2-mtmr12 Fig. 2 with image from Gupta et al., 2013
locomotory behavior disrupted, abnormal AB + MO2-mtmr12 Fig. SMovie S1 from Gupta et al., 2013
muscle cell nucleus displaced to muscle cell central region, abnormal AB + MO2-mtmr12 Fig. 3 with image from Gupta et al., 2013
pericardium edematous, abnormal AB + MO2-mtmr12 Fig. 2 with image from Gupta et al., 2013
skeletal muscle refractivity, abnormal AB + MO2-mtmr12 Fig. 2 with image,  Fig. 7 with image from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal AB + MO2-mtmr12 Fig. 3 with image from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal AB + MO2-mtmr12 Fig. 3 with image from Gupta et al., 2013
skeletal muscle T-tubule absent, abnormal AB + MO2-mtmr12 Fig. 4 with image from Gupta et al., 2013
skeletal muscle T-tubule disorganized, abnormal AB + MO2-mtmr12 Fig. 4 with image,  Fig. 7 with image from Gupta et al., 2013
thigmotaxis disrupted, abnormal AB + MO2-mtmr12 Fig. 2 with image from Gupta et al., 2013
trunk curved dorsal, abnormal AB + MO2-mtmr12 Fig. 2 with image from Gupta et al., 2013
whole organism decreased length, abnormal AB + MO2-mtmr12 Fig. 7 with image from Gupta et al., 2013
whole organism decreased mobility, abnormal AB + MO2-mtmr12 Fig. 2 with image,  Fig. SMovie S1 from Gupta et al., 2013
Phenotype of all Fish created by or utilizing MO2-mtmr12
Phenotype Fish Conditions Figures
whole organism decreased mobility, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with image,  Fig. SMovie S1 from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal AB + MO2-mtmr12 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal AB + MO2-mtmr12 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle T-tubule disorganized, abnormal AB + MO2-mtmr12 standard conditions Fig. 4 with image,  Fig. 7 with image from Gupta et al., 2013
trunk curved dorsal, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with image from Gupta et al., 2013
whole organism decreased length, abnormal AB + MO2-mtmr12 standard conditions Fig. 7 with image from Gupta et al., 2013
locomotory behavior disrupted, abnormal AB + MO2-mtmr12 standard conditions Fig. SMovie S1 from Gupta et al., 2013
thigmotaxis disrupted, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with image from Gupta et al., 2013
muscle cell nucleus displaced to muscle cell central region, abnormal AB + MO2-mtmr12 standard conditions Fig. 3 with image from Gupta et al., 2013
hatching decreased occurrence, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with image from Gupta et al., 2013
pericardium edematous, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with image from Gupta et al., 2013
skeletal muscle refractivity, abnormal AB + MO2-mtmr12 standard conditions Fig. 2 with image,  Fig. 7 with image from Gupta et al., 2013
skeletal muscle T-tubule absent, abnormal AB + MO2-mtmr12 standard conditions Fig. 4 with image from Gupta et al., 2013
skeletal muscle refractivity, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 2 with image,  Fig. 7 with image from Gupta et al., 2013
muscle cell nucleus displaced to muscle cell central region, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle non-functional, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 4 with image from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle Z disc absent, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 4 with image from Gupta et al., 2013
thigmotaxis disrupted, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. SMovie S1 from Gupta et al., 2013
whole organism decreased length, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 7 with image from Gupta et al., 2013
skeletal muscle T-tubule disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 7 with image from Gupta et al., 2013
whole organism decreased size, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 2 with image from Gupta et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.