Morpholino

MO4-mtm1

ID
ZDB-MRPHLNO-130910-6
Name
MO4-mtm1
Previous Names
  • translational MO (1)
Target
Sequence
5' - AGCCAGACCCTCGTCGAAAAGTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-mtm1
No data available
Phenotype
Phenotype resulting from MO4-mtm1
Phenotype of all Fish created by or utilizing MO4-mtm1
Phenotype Fish Conditions Figures
locomotory behavior disrupted, abnormal AB + MO4-mtm1 standard conditions Fig. SMovie S1 from Gupta et al., 2013
whole organism decreased length, abnormal AB + MO4-mtm1 standard conditions Fig. 7 with image from Gupta et al., 2013
skeletal muscle T-tubule absent, abnormal AB + MO4-mtm1 standard conditions Fig. 4 with image from Gupta et al., 2013
skeletal muscle T-tubule disorganized, abnormal AB + MO4-mtm1 standard conditions Fig. 4 with imageFig. 7 with image from Gupta et al., 2013
whole organism decreased mobility, abnormal AB + MO4-mtm1 standard conditions Fig. SMovie S1 from Gupta et al., 2013
skeletal muscle refractivity, abnormal AB + MO4-mtm1 standard conditions Fig. 2 with imageFig. 7 with image from Gupta et al., 2013
hatching decreased occurrence, abnormal AB + MO4-mtm1 standard conditions text only from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal AB + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
muscle cell nucleus displaced to muscle cell central region, abnormal AB + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
trunk curved dorsal, abnormal AB + MO4-mtm1 standard conditions Fig. 2 with image from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal AB + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
muscle morphology, abnormal WT + MO4-mtm1 standard conditions Fig. 3 from Smith et al., 2013
skeletal muscle refractivity, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 2 with imageFig. 7 with image from Gupta et al., 2013
muscle cell nucleus displaced to muscle cell central region, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle non-functional, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 4 with image from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 3 with image from Gupta et al., 2013
skeletal muscle Z disc absent, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 4 with image from Gupta et al., 2013
thigmotaxis disrupted, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. SMovie S1 from Gupta et al., 2013
whole organism decreased length, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 7 with image from Gupta et al., 2013
skeletal muscle T-tubule disorganized, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 7 with image from Gupta et al., 2013
whole organism decreased size, abnormal AB + MO2-mtmr12 + MO4-mtm1 standard conditions Fig. 2 with image from Gupta et al., 2013
Citations