Morpholino

MO1-gmppb

ID

ZDB-MRPHLNO-130828-1

Name

MO1-gmppb

Previous Names

None

Target

gmppb (1)

Sequence

5' - GGACCAGCTGAAAACAGAAACAGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

intron 4 - exon 5 Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gmppb

Expressed Gene	Anatomy	Figures
dag1	myoseptum whole organism	Fig. 6, Fig. S12 from Carss et al., 2013

Phenotype

Phenotype resulting from MO1-gmppb

Phenotype	Fish	Figures
CaP motoneuron axon decreased length, abnormal	ml2Tg + MO1-gmppb	Fig. 3 , Fig. 4 from Liu et al., 2021 Fig. 7 from Zheng et al., 2021
eye decreased size, abnormal	WT + MO1-gmppb	Fig. 6, Fig. S11 from Carss et al., 2013
multicellular organismal locomotion decreased process quality, abnormal	AB + MO1-gmppb	Fig. 3 from Liu et al., 2021
muscle sarcolemma damaged, abnormal	WT + MO1-gmppb	Fig. 6 from Carss et al., 2013
myoseptum damaged, abnormal	WT + MO1-gmppb	Fig. 6, Fig. S12 from Carss et al., 2013
myoseptum increased width, abnormal	WT + MO1-gmppb	Fig. S12 from Carss et al., 2013
nervous system EGFP expression decreased amount, abnormal	knu3Tg + MO1-gmppb	Fig. 3 from Liu et al., 2021
post-vent region bent, abnormal	WT + MO1-gmppb	Fig. 6 from Carss et al., 2013
protein glycosylation decreased occurrence, abnormal	AB/TU + MO1-gmppb + MO4-tp53	Fig. Extended Data Fig. 9 from Zheng et al., 2021
protein glycosylation decreased process quality, abnormal	WT + MO1-gmppb	Fig. 6 from Carss et al., 2013
skeletal muscle cell disorganized, abnormal	AB + MO1-gmppb	Fig. 4 from Liu et al., 2021 Fig. 7 from Zheng et al., 2021 Fig. 6 from Carss et al., 2013
skeletal muscle cell sparse, abnormal	AB + MO1-gmppb	Fig. 4 from Liu et al., 2021 Fig. 7 from Zheng et al., 2021 Fig. 6 from Carss et al., 2013
whole organism Ab1-gmppb labeling decreased amount, abnormal	AB/TU + MO1-gmppb + MO4-tp53	Fig. 3 from Liu et al., 2021 Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism sox2 expression decreased amount, abnormal	AB/TU + MO1-gmppb + MO4-tp53	Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism decreased length, abnormal	WT + MO1-gmppb	Fig. 6 from Carss et al., 2013
whole organism decreased mobility, abnormal	WT + MO1-gmppb	text only from Carss et al., 2013
whole organism decreased pigmentation, abnormal	WT + MO1-gmppb	Fig. 6 from Carss et al., 2013
whole organism GDP-mannose decreased amount, abnormal	AB/TU + MO1-gmppb + MO4-tp53	Fig. Extended Data Fig. 9 from Zheng et al., 2021

Phenotype of all Fish created by or utilizing MO1-gmppb

Phenotype	Fish	Conditions	Figures
whole organism Ab1-gmppb labeling decreased amount, abnormal	AB + MO1-gmppb	standard conditions	Fig. 3 from Liu et al., 2021
multicellular organismal locomotion decreased process quality, abnormal	AB + MO1-gmppb	standard conditions	Fig. 3 from Liu et al., 2021
skeletal muscle cell sparse, abnormal	AB + MO1-gmppb	standard conditions	Fig. 4 from Liu et al., 2021
skeletal muscle cell disorganized, abnormal	AB + MO1-gmppb	standard conditions	Fig. 4 from Liu et al., 2021
whole organism Ab1-gmppb labeling decreased amount, abnormal	AB/TU + MO1-gmppb + MO4-tp53	standard conditions	Fig. Extended Data Fig. 9 from Zheng et al., 2021
skeletal muscle cell morphology, ameliorated	AB/TU + MO1-gmppb + MO4-tp53	chemical treatment by injection: GDP-mannose	Fig. 7 from Zheng et al., 2021
whole organism sox2 expression amount, ameliorated	AB/TU + MO1-gmppb + MO4-tp53	chemical treatment by injection: GDP-mannose	Fig. Extended Data Fig. 9 from Zheng et al., 2021
skeletal muscle cell sparse, abnormal	AB/TU + MO1-gmppb + MO4-tp53	standard conditions	Fig. 7 from Zheng et al., 2021
protein glycosylation decreased occurrence, abnormal	AB/TU + MO1-gmppb + MO4-tp53	standard conditions	Fig. Extended Data Fig. 9 from Zheng et al., 2021
skeletal muscle cell disorganized, abnormal	AB/TU + MO1-gmppb + MO4-tp53	standard conditions	Fig. 7 from Zheng et al., 2021
whole organism GDP-mannose decreased amount, abnormal	AB/TU + MO1-gmppb + MO4-tp53	standard conditions	Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism sox2 expression decreased amount, abnormal	AB/TU + MO1-gmppb + MO4-tp53	standard conditions	Fig. Extended Data Fig. 9 from Zheng et al., 2021
muscle sarcolemma damaged, abnormal	WT + MO1-gmppb	standard conditions	Fig. 6 from Carss et al., 2013
whole organism decreased length, abnormal	WT + MO1-gmppb	standard conditions	Fig. 6 from Carss et al., 2013
skeletal muscle cell disorganized, abnormal	WT + MO1-gmppb	standard conditions	Fig. 6 from Carss et al., 2013
whole organism decreased mobility, abnormal	WT + MO1-gmppb	standard conditions	text only from Carss et al., 2013
myoseptum increased width, abnormal	WT + MO1-gmppb	standard conditions	Fig. S12 from Carss et al., 2013
myoseptum damaged, abnormal	WT + MO1-gmppb	standard conditions	Fig. 6, Fig. S12 from Carss et al., 2013
skeletal muscle cell sparse, abnormal	WT + MO1-gmppb	standard conditions	Fig. 6 from Carss et al., 2013
post-vent region bent, abnormal	WT + MO1-gmppb	standard conditions	Fig. 6 from Carss et al., 2013
protein glycosylation decreased process quality, abnormal	WT + MO1-gmppb	standard conditions	Fig. 6 from Carss et al., 2013
whole organism decreased pigmentation, abnormal	WT + MO1-gmppb	standard conditions	Fig. 6 from Carss et al., 2013
eye decreased size, abnormal	WT + MO1-gmppb	standard conditions	Fig. 6, Fig. S11 from Carss et al., 2013
nervous system EGFP expression decreased amount, abnormal	knu3Tg + MO1-gmppb	standard conditions	Fig. 3 from Liu et al., 2021
CaP motoneuron axon decreased length, abnormal	ml2Tg + MO1-gmppb	standard conditions	Fig. 3 , Fig. 4 from Liu et al., 2021
CaP motoneuron axon length, ameliorated	ml2Tg + MO1-gmppb + MO4-tp53	chemical treatment by injection: GDP-mannose	Fig. 7 from Zheng et al., 2021
CaP motoneuron axon decreased length, abnormal	ml2Tg + MO1-gmppb + MO4-tp53	standard conditions	Fig. 7 from Zheng et al., 2021

Citations