Morpholino

MO1-klhl40a

ID
ZDB-MRPHLNO-130823-1
Name
MO1-klhl40a
Previous Names
  • klhl40a-MO (1)
Target
Sequence
5' - GGTCCACTGACATGGAGGCCATCTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-klhl40a
No data available
Phenotype
Phenotype resulting from MO1-klhl40a
Phenotype of all Fish created by or utilizing MO1-klhl40a
Phenotype Fish Conditions Figures
skeletal muscle myofibril undulate, abnormal WT + MO1-klhl40a standard conditions Fig. 4 from Ravenscroft et al., 2013
embryo development delayed, abnormal WT + MO1-klhl40a standard conditions Fig. 4 from Ravenscroft et al., 2013
skeletal muscle myofibril loose, abnormal WT + MO1-klhl40a standard conditions Fig. 4 from Ravenscroft et al., 2013
post-vent region morphology, abnormal WT + MO1-klhl40a standard conditions Fig. 4 from Ravenscroft et al., 2013
trunk curved, abnormal WT + MO1-klhl40a standard conditions Fig. 4 from Ravenscroft et al., 2013
skeletal muscle cell Z disc aggregated, abnormal WT + MO1-klhl40a + MO1-klhl40b standard conditions Fig. 4Fig. S11 from Ravenscroft et al., 2013
skeletal muscle myofibril undulate, abnormal WT + MO1-klhl40a + MO1-klhl40b standard conditions Fig. 4 from Ravenscroft et al., 2013
skeletal muscle cell Z disc disorganized, abnormal WT + MO1-klhl40a + MO1-klhl40b standard conditions Fig. 4 from Ravenscroft et al., 2013
embryo development delayed, abnormal WT + MO1-klhl40a + MO1-klhl40b standard conditions Fig. 4 from Ravenscroft et al., 2013
skeletal muscle myofibril disorganized, abnormal WT + MO1-klhl40a + MO1-klhl40b standard conditions Fig. 4 from Ravenscroft et al., 2013
trunk curved, abnormal WT + MO1-klhl40a + MO1-klhl40b standard conditions Fig. 4 from Ravenscroft et al., 2013
post-vent region morphology, abnormal WT + MO1-klhl40a + MO1-klhl40b standard conditions Fig. 4 from Ravenscroft et al., 2013
skeletal muscle myofibril loose, abnormal WT + MO1-klhl40a + MO1-klhl40b standard conditions Fig. 4 from Ravenscroft et al., 2013
skeletal muscle cell Z disc increased width, abnormal WT + MO1-klhl40a + MO1-klhl40b standard conditions Fig. 4 from Ravenscroft et al., 2013
skeletal muscle myofibril loose, abnormal WT + MO1-klhl40a + MO2-klhl40b standard conditions Fig. S10 from Ravenscroft et al., 2013
swimming process quality, abnormal WT + MO1-klhl40a + MO2-klhl40b standard conditions Fig. SMovie2 from Ravenscroft et al., 2013
whole organism refractivity, abnormal WT + MO1-klhl40a + MO2-klhl40b standard conditions Fig. S10 from Ravenscroft et al., 2013
skeletal muscle myofibril undulate, abnormal WT + MO1-klhl40a + MO2-klhl40b standard conditions Fig. S10 from Ravenscroft et al., 2013
Citations