Morpholino

MO1-pax3b

ID

ZDB-MRPHLNO-130821-1

Name

MO1-pax3b

Previous Names

None

Target

pax3b (1)

Sequence

5' - CCTGGGAAAGCGGTCATTGCTCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pax3b

Expressed Gene	Anatomy	Figures
dlx2a	neural crest	Fig. 5 from Minchin et al., 2013
lbx2	head skeletal muscle myoblast	Fig. 5 from Minchin et al., 2013

Phenotype

Phenotype resulting from MO1-pax3b

Phenotype	Fish	Figures
branchiomeric skeletal muscle development decreased process quality, abnormal	zf13Tg + MO1-pax3b	Fig. 5 , Fig. 6 , Fig. 7 from Minchin et al., 2013
esophagus lacks parts or has fewer parts of type skeletal muscle cell, abnormal	WT + MO1-pax3b	Fig. 6 from Minchin et al., 2013
esophagus skeletal muscle cell poorly differentiated, abnormal	WT + MO1-pax3b	Fig. 5 from Minchin et al., 2013
mastication decreased process quality, abnormal	WT + MO1-pax3b	Fig. 7 from Minchin et al., 2013
pectoral fin musculature decreased size, abnormal	zf13Tg + MO1-pax3b	Fig. 7 from Minchin et al., 2013
pectoral fin musculature disorganized, abnormal	zf13Tg + MO1-pax3b	Fig. 7 from Minchin et al., 2013
sternohyoid decreased size, abnormal	zf13Tg + MO1-pax3b	Fig. 7 from Minchin et al., 2013
sternohyoid disorganized, abnormal	zf13Tg + MO1-pax3b	Fig. 7 from Minchin et al., 2013

Phenotype of all Fish created by or utilizing MO1-pax3b

Phenotype	Fish	Conditions	Figures
esophagus lacks parts or has fewer parts of type skeletal muscle cell, abnormal	WT + MO1-pax3b	standard conditions	Fig. 6 from Minchin et al., 2013
branchiomeric skeletal muscle development decreased process quality, abnormal	WT + MO1-pax3b	standard conditions	Fig. 5 , Fig. 6 from Minchin et al., 2013
mastication decreased process quality, abnormal	WT + MO1-pax3b	standard conditions	Fig. 7 from Minchin et al., 2013
esophagus skeletal muscle cell poorly differentiated, abnormal	WT + MO1-pax3b	standard conditions	Fig. 5 from Minchin et al., 2013
branchiomeric skeletal muscle development decreased process quality, abnormal	zf13Tg + MO1-pax3b	standard conditions	Fig. 7 from Minchin et al., 2013
pectoral fin musculature disorganized, abnormal	zf13Tg + MO1-pax3b	standard conditions	Fig. 7 from Minchin et al., 2013
sternohyoid disorganized, abnormal	zf13Tg + MO1-pax3b	standard conditions	Fig. 7 from Minchin et al., 2013
sternohyoid decreased size, abnormal	zf13Tg + MO1-pax3b	standard conditions	Fig. 7 from Minchin et al., 2013
pectoral fin musculature decreased size, abnormal	zf13Tg + MO1-pax3b	standard conditions	Fig. 7 from Minchin et al., 2013
esophagus lacks parts or has fewer parts of type skeletal muscle cell, abnormal	WT + MO1-pax3b + MO3-pax3a	standard conditions	Fig. 6 from Minchin et al., 2013
branchiomeric skeletal muscle development decreased process quality, abnormal	WT + MO1-pax3b + MO3-pax3a	standard conditions	Fig. 5 , Fig. 6 from Minchin et al., 2013
esophagus skeletal muscle cell poorly differentiated, abnormal	WT + MO1-pax3b + MO3-pax3a	standard conditions	Fig. 5 from Minchin et al., 2013
mastication decreased process quality, abnormal	WT + MO1-pax3b + MO3-pax3a	standard conditions	Fig. 7 from Minchin et al., 2013
sternohyoid decreased size, abnormal	zf13Tg + MO1-pax3b + MO3-pax3a	standard conditions	Fig. 7 from Minchin et al., 2013
pectoral fin musculature decreased size, abnormal	zf13Tg + MO1-pax3b + MO3-pax3a	standard conditions	Fig. 7 from Minchin et al., 2013
pectoral fin musculature disorganized, abnormal	zf13Tg + MO1-pax3b + MO3-pax3a	standard conditions	Fig. 7 from Minchin et al., 2013
sternohyoid disorganized, abnormal	zf13Tg + MO1-pax3b + MO3-pax3a	standard conditions	Fig. 7 from Minchin et al., 2013
branchiomeric skeletal muscle development decreased process quality, abnormal	zf13Tg + MO1-pax3b + MO3-pax3a	standard conditions	Fig. 7 from Minchin et al., 2013

Citations