Morpholino

MO3-cxxc5a

ID
ZDB-MRPHLNO-130729-9
Name
MO3-cxxc5a
Previous Names
  • ATG (1)
Target
Sequence
5' - CTGTCCGCCAGACATGGTCCAGCCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-cxxc5a
Expressed Gene Anatomy Figures
gata4 Fig. S3 from Peng et al., 2016
hand2 Fig. S3 from Peng et al., 2016
has2 Fig. S3 from Peng et al., 2016
nkx2.5 Fig. S3 from Peng et al., 2016
Phenotype
Phenotype resulting from MO3-cxxc5a
Phenotype Fish Figures
cardiac ventricle decreased angle to atrium, abnormal hn1Tg + MO3-cxxc5a Fig. 3 from Peng et al., 2016
heart dysplastic, abnormal hn1Tg + MO3-cxxc5a Fig. 3 from Peng et al., 2016
heart edematous, abnormal hn1Tg + MO3-cxxc5a Fig. 3 from Peng et al., 2016
heart straight, abnormal hn1Tg + MO3-cxxc5a Fig. 3 from Peng et al., 2016
heart contraction decreased rate, abnormal AB + MO3-cxxc5a Fig. S3 from Peng et al., 2016
heart jogging disrupted, abnormal hn1Tg + MO3-cxxc5a Fig. 3 from Peng et al., 2016
heart looping disrupted, abnormal hn1Tg + MO3-cxxc5a Fig. 3 from Peng et al., 2016
whole organism dead, abnormal hn1Tg + MO3-cxxc5a Fig. 3 from Peng et al., 2016
whole organism gata4 expression decreased amount, abnormal AB + MO3-cxxc5a Fig. S3 from Peng et al., 2016
whole organism has2 expression decreased amount, abnormal AB + MO3-cxxc5a Fig. S3 from Peng et al., 2016
whole organism hand2 expression decreased amount, abnormal AB + MO3-cxxc5a Fig. S3 from Peng et al., 2016
whole organism nkx2.5 expression decreased amount, abnormal AB + MO3-cxxc5a Fig. S3 from Peng et al., 2016
Phenotype of all Fish created by or utilizing MO3-cxxc5a
Phenotype Fish Conditions Figures
whole organism has2 expression decreased amount, abnormal AB + MO3-cxxc5a standard conditions Fig. S3 from Peng et al., 2016
whole organism gata4 expression decreased amount, abnormal AB + MO3-cxxc5a standard conditions Fig. S3 from Peng et al., 2016
heart contraction decreased rate, abnormal AB + MO3-cxxc5a standard conditions Fig. S3 from Peng et al., 2016
whole organism nkx2.5 expression decreased amount, abnormal AB + MO3-cxxc5a standard conditions Fig. S3 from Peng et al., 2016
whole organism hand2 expression decreased amount, abnormal AB + MO3-cxxc5a standard conditions Fig. S3 from Peng et al., 2016
heart straight, abnormal hn1Tg + MO3-cxxc5a standard conditions Fig. 3 from Peng et al., 2016
heart looping disrupted, abnormal hn1Tg + MO3-cxxc5a standard conditions Fig. 3 from Peng et al., 2016
cardiac ventricle decreased angle to atrium, abnormal hn1Tg + MO3-cxxc5a standard conditions Fig. 3 from Peng et al., 2016
heart edematous, abnormal hn1Tg + MO3-cxxc5a standard conditions Fig. 3 from Peng et al., 2016
heart dysplastic, abnormal hn1Tg + MO3-cxxc5a standard conditions Fig. 3 from Peng et al., 2016
whole organism dead, abnormal hn1Tg + MO3-cxxc5a standard conditions Fig. 3 from Peng et al., 2016
heart jogging disrupted, abnormal hn1Tg + MO3-cxxc5a standard conditions Fig. 3 from Peng et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.