Morpholino
MO1-vapb
- ID
- ZDB-MRPHLNO-130625-1
- Name
- MO1-vapb
- Previous Names
- None
- Target
- Sequence
-
5' - CCATCTCCCACTGCAAACGCTCGGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-vapb
No data available
Phenotype
Phenotype resulting from MO1-vapb
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-vapb
1 - 5 of 10 Show all
Citations
- Silbernagel, N., Walecki, M., Schäfer, M.K., Kessler, M., Zobeiri, M., Rinné, S., Kiper, A.K., Komadowski, M.A., Vowinkel, K.S., Wemhöner, K., Fortmüller, L., Schewe, M., Dolga, A.M., Scekic-Zahirovic, J., Matschke, L.A., Culmsee, C., Baukrowitz, T., Monassier, L., Ullrich, N.D., Dupuis, L., Just, S., Budde, T., Fabritz, L., Decher, N. (2018) The VAMP-associated protein VAPB is required for cardiac and neuronal pacemaker channel function. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 32(11):6159-6173
- Kabashi, E., El Oussini, H., Bercier, V., Gros-Louis, F., Valdmanis, P.N., McDearmid, J., Mejier, I.A., Dion, P.A., Dupre, N., Hollinger, D., Sinniger, J., Dirrig-Grosch, S., Camu, W., Meininger, V., Loeffler, J.P., René, F., Drapeau, P., Rouleau, G.A., and Dupuis, L. (2013) Investigating the contribution of VAPB/ALS8 loss of function in amyotrophic lateral sclerosis. Human molecular genetics. 22(12):2350-60
1 - 2 of 2
Show