Morpholino
MO1-kdm6a
- ID
- ZDB-MRPHLNO-130521-1
- Name
- MO1-kdm6a
- Previous Names
- None
- Target
- Sequence
-
5' - CCACCGACACTCCGCACGATTTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kdm6a
No data available
Phenotype
Phenotype resulting from MO1-kdm6a
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-kdm6a
1 - 5 of 9 Show all
Citations
- Lindgren, A.M., Hoyos, T., Talkowski, M.E., Hanscom, C., Blumenthal, I., Chiang, C., Ernst, C., Pereira, S., Ordulu, Z., Clericuzio, C., Drautz, J.M., Rosenfeld, J.A., Shaffer, L.G., Velsher, L., Pynn, T., Vermeesch, J., Harris, D.J., Gusella, J.F., Liao, E.C., and Morton, C.C. (2013) Haploinsufficiency of KDM6A is associated with severe psychomotor retardation, global growth restriction, seizures and cleft palate. Human genetics. 132(5):537-552
- Thieme, S., Gyárfás, T., Richter, C., Özhan, G., Fu, J., Alexopulou, D., Muders, M.H., Michalk, I., Jakob, C., Dahl, A., Klink, B., Bandola, J., Bachmann, M., Schröck, E., Buchholz, F., Stewart, A.F., Weidinger, G., Anastassiadis, K., and Brenner, S. (2013) The histone demethylase UTX regulates stem cell migration and hematopoiesis. Blood. 121(13):2462-2473
1 - 2 of 2
Show