Morpholino
MO2-gpc1a
- ID
- ZDB-MRPHLNO-130516-6
- Name
- MO2-gpc1a
- Previous Names
-
- gpc1-IE4 (1)
- Target
- Sequence
-
5' - GGGACCTGTGGAAAGAGTGACCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gpc1a
No data available
Phenotype
Phenotype resulting from MO2-gpc1a
| Phenotype | Fish | Figures |
|---|---|---|
| intrahepatic bile duct decreased functionality, abnormal | TL + MO2-gpc1a |
Fig. S1
from Cui et al., 2013 |
Phenotype of all Fish created by or utilizing MO2-gpc1a
Citations