Morpholino

MO1-hoxd4a

ID

ZDB-MRPHLNO-130509-3

Name

MO1-hoxd4a

Previous Names

MO1 (1)

Target

hoxd4a (1)

Sequence

5' - GTTCACTGTGAAGGACAAAATCACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hoxd4a

No data available

Phenotype

Phenotype resulting from MO1-hoxd4a

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	y1Tg + MO1-hoxd4a	Fig. 4 from Amali et al., 2013
caudal vein plexus aplastic, abnormal	y1Tg + MO1-hoxd4a	Fig. 4 from Amali et al., 2013
definitive hemopoiesis disrupted, abnormal	AB + MO1-hoxd4a	Fig. 3 from Amali et al., 2013
intersegmental vessel malformed, abnormal	WT + MO1-hoxd4a	Fig. 1, Fig. 2 from Zhang et al., 2020
nucleate erythrocyte decreased amount, abnormal	WT + MO1-hoxd4a	Fig. 1, Fig. 2, Fig. 5, Fig. 6 from Zhang et al., 2020
posterior lateral mesoderm tal1 expression decreased amount, abnormal	WT + MO1-hoxd4a	Fig. 1, Fig. 2 from Zhang et al., 2020
posterior lateral mesoderm fli1 expression decreased amount, abnormal	WT + MO1-hoxd4a	Fig. 1, Fig. 2 from Zhang et al., 2020
primitive hemopoiesis disrupted, abnormal	AB + MO1-hoxd4a	Fig. 2 , Fig. 3 from Amali et al., 2013
subintestinal vein aplastic, abnormal	AB + MO1-hoxd4a	Fig. 4 from Amali et al., 2013
subintestinal venous plexus malformed, abnormal	WT + MO1-hoxd4a	Fig. 1, Fig. 2 from Zhang et al., 2020
vasculature lacks parts or has fewer parts of type intersegmental vessel, abnormal	AB + MO1-hoxd4a	Fig. 4 from Amali et al., 2013
vasculogenesis disrupted, abnormal	y1Tg + MO1-hoxd4a	Fig. 4 from Amali et al., 2013
vertebral artery aplastic, abnormal	AB + MO1-hoxd4a	Fig. 4 from Amali et al., 2013
whole organism tal1 expression decreased amount, abnormal	WT + MO1-hoxd4a	Fig. 2 from Zhang et al., 2020
whole organism fli1 expression decreased amount, abnormal	WT + MO1-hoxd4a	Fig. 2 from Zhang et al., 2020

Phenotype of all Fish created by or utilizing MO1-hoxd4a

Phenotype	Fish	Conditions	Figures
nucleate erythrocyte decreased amount, abnormal	hoxd4a^{zf3363/zf3363} + MO1-hoxd4a	standard conditions	Fig. 6 from Zhang et al., 2020
vertebral artery aplastic, abnormal	AB + MO1-hoxd4a	standard conditions	Fig. 4 from Amali et al., 2013
vasculature lacks parts or has fewer parts of type intersegmental vessel, abnormal	AB + MO1-hoxd4a	standard conditions	Fig. 4 from Amali et al., 2013
primitive hemopoiesis disrupted, abnormal	AB + MO1-hoxd4a	standard conditions	Fig. 2 , Fig. 3 from Amali et al., 2013
definitive hemopoiesis disrupted, abnormal	AB + MO1-hoxd4a	standard conditions	Fig. 3 from Amali et al., 2013
subintestinal vein aplastic, abnormal	AB + MO1-hoxd4a	standard conditions	Fig. 4 from Amali et al., 2013
whole organism tal1 expression decreased amount, abnormal	WT + MO1-hoxd4a	control	Fig. 2 from Zhang et al., 2020
posterior lateral mesoderm fli1 expression decreased amount, abnormal	WT + MO1-hoxd4a	control	Fig. 1, Fig. 2 from Zhang et al., 2020
intersegmental vessel malformed, abnormal	WT + MO1-hoxd4a	control	Fig. 1, Fig. 2 from Zhang et al., 2020
subintestinal venous plexus malformed, abnormal	WT + MO1-hoxd4a	control	Fig. 1, Fig. 2 from Zhang et al., 2020
whole organism fli1 expression decreased amount, abnormal	WT + MO1-hoxd4a	control	Fig. 2 from Zhang et al., 2020
posterior lateral mesoderm tal1 expression decreased amount, abnormal	WT + MO1-hoxd4a	control	Fig. 1, Fig. 2 from Zhang et al., 2020
nucleate erythrocyte decreased amount, abnormal	WT + MO1-hoxd4a	standard conditions	Fig. 1, Fig. 2, Fig. 5, Fig. 6 from Zhang et al., 2020
caudal vein plexus aplastic, abnormal	y1Tg + MO1-hoxd4a	standard conditions	Fig. 4 from Amali et al., 2013
vasculogenesis disrupted, abnormal	y1Tg + MO1-hoxd4a	standard conditions	Fig. 4 from Amali et al., 2013
angiogenesis disrupted, abnormal	y1Tg + MO1-hoxd4a	standard conditions	Fig. 4 from Amali et al., 2013

Citations