Morpholino

MO3-eaf1

ID

ZDB-MRPHLNO-130501-8

Name

MO3-eaf1

Previous Names

None

Target

Sequence

5' - GTCTCTCTTGATGGACTCACATCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-eaf1

Expressed Gene	Anatomy	Figures
alas2	intermediate cell mass of mesoderm	Fig. 2 from Hu et al., 2014
cdx4	mesoderm posterior region	Fig. S3 from Liu et al., 2013
foxg1a	(not) neuroectoderm anterior region	Fig. S3 from Liu et al., 2013
foxo3b	whole organism	Fig. 3 from Hu et al., 2014
gata1a	erythroid lineage cell intermediate cell mass of mesoderm posterior lateral mesoderm	Fig. 1 from Hu et al., 2014
gata2a	posterior lateral mesoderm	Fig. 1 from Hu et al., 2014
gsc	blastodisc	Fig. S3 from Liu et al., 2013
hbae1.1	erythroid lineage cell	Fig. 2 from Hu et al., 2014
hbae3	erythroid lineage cell	Fig. 2 from Hu et al., 2014
hbbe1.1	erythroid lineage cell	Fig. 2 from Hu et al., 2014
lcp1	monocyte	Fig. 2 from Hu et al., 2014
lmo2	posterior lateral mesoderm	Fig. 1 from Hu et al., 2014
mpx	granulocyte	Fig. 2 from Hu et al., 2014
myb	hematopoietic stem cell ventral wall of dorsal aorta	Fig. 2 from Hu et al., 2014
ndr1	blastodisc	Fig. S3 from Liu et al., 2013
rag1	(not) T cell (not) thymus	Fig. 2 from Hu et al., 2014
rag2	(not) T cell (not) thymus	Fig. 2 from Hu et al., 2014
runx1	hematopoietic stem cell ventral wall of dorsal aorta	Fig. 2 from Hu et al., 2014
six3b	unspecified	Fig. 1 from Liu et al., 2013
spi1b	anterior lateral mesoderm myeloid cell	Fig. 1 from Hu et al., 2014
tal1	posterior lateral mesoderm	Fig. 1 from Hu et al., 2014
tbx6	ventral mesoderm	Fig. S3 from Liu et al., 2013

Phenotype

Phenotype resulting from MO3-eaf1

Phenotype	Fish	Figures
hemopoiesis process quality, abnormal	AB + MO3-eaf1	Fig. 2 from Hu et al., 2014
lymphocyte differentiation decreased process quality, abnormal	AB + MO3-eaf1	Fig. 2 from Hu et al., 2014
myeloid cell development process quality, abnormal	AB + MO3-eaf1	Fig. 1 , Fig. 2 from Hu et al., 2014
neuroectoderm anterior region decreased size, abnormal	WT + MO3-eaf1	Fig. 1 from Liu et al., 2013
primitive hemopoiesis process quality, abnormal	AB + MO3-eaf1	Fig. 2 from Hu et al., 2014

Phenotype of all Fish created by or utilizing MO3-eaf1

Phenotype	Fish	Conditions	Figures
myeloid cell development process quality, abnormal	AB + MO3-eaf1	standard conditions	Fig. 1 , Fig. 2 from Hu et al., 2014
hemopoiesis process quality, abnormal	AB + MO3-eaf1	standard conditions	Fig. 2 from Hu et al., 2014
lymphocyte differentiation decreased process quality, abnormal	AB + MO3-eaf1	standard conditions	Fig. 2 from Hu et al., 2014
primitive hemopoiesis process quality, abnormal	AB + MO3-eaf1	standard conditions	Fig. 2 from Hu et al., 2014
neuroectoderm anterior region decreased size, abnormal	WT + MO3-eaf1	standard conditions	Fig. 1 from Liu et al., 2013

Citations