Morpholino
MO1-nfatc4
- ID
- ZDB-MRPHLNO-130425-3
- Name
- MO1-nfatc4
- Previous Names
-
- nfatc4-splice-MO (1)
- Target
- Sequence
-
5' - CAGGAAAATGTGCTTCCCACCTGTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nfatc4
No data available
Phenotype
Phenotype resulting from MO1-nfatc4
No data available
Phenotype of all Fish created by or utilizing MO1-nfatc4
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| slow muscle cell decreased amount, abnormal | AB + MO1-nfatc4 + MO1-nfixa | standard conditions |
Fig. 5 
from Pistocchi et al., 2013 |
1 - 1 of 1
Citations
- Chu, L., Terasaki, M., Mattsson, C.L., Teinturier, R., Charbord, J., Dirice, E., Liu, K.C., Miskelly, M.G., Zhou, Q., Wierup, N., Kulkarni, R.N., Andersson, O. (2022) In vivo drug discovery for increasing incretin-expressing cells identifies DYRK inhibitors that reinforce the enteroendocrine system. Cell chemical biology. 29(9):1368-1380.e5
- Pistocchi, A., Gaudenzi, G., Foglia, E., Monteverde, S., Moreno-Fortuny, A., Pianca, A., Cossu, G., Cotelli, F., and Messina, G. (2013) Conserved and divergent functions of Nfix in skeletal muscle development during vertebrate evolution. Development (Cambridge, England). 140(7):1528-1536
1 - 2 of 2
Show