Morpholino

MO1-nfixa

ID

ZDB-MRPHLNO-130425-1

Name

MO1-nfixa

Previous Names

None

Target

nfixa (1)

Sequence

5' - CCGGTCTCAAAGGCGGGAAATGATT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-nfixa

Expressed Gene	Anatomy	Figures
myl1	whole organism	Fig. 6 from Taglietti et al., 2016
nfatc4	whole organism	Fig. 5 from Pistocchi et al., 2013
smyhc1	slow muscle cell whole organism	Fig. 6 from Taglietti et al., 2016 Fig. 4 from Pistocchi et al., 2013

Phenotype

Phenotype resulting from MO1-nfixa

Phenotype	Fish	Figures
muscle has fewer parts of type muscle cell sarcoplasmic reticulum, abnormal	AB + MO1-nfixa	Fig. 3 from Pistocchi et al., 2013
muscle cell proliferation increased occurrence, abnormal	AB + MO1-nfixa	Fig. 6 from Pistocchi et al., 2013
muscle precursor cell decreased amount, abnormal	WT + MO1-nfixa	Fig. 7 from Pistocchi et al., 2013
skeletal muscle myofibril disorganized, abnormal	AB + MO1-nfixa	Fig. 3 from Pistocchi et al., 2013
skeletal muscle fiber development disrupted, abnormal	AB + MO1-nfixa	Fig. 6 from Pistocchi et al., 2013
swimming decreased process quality, abnormal	AB + MO1-nfixa	Fig. S6 from Taglietti et al., 2016
swimming behavior disrupted, abnormal	AB + MO1-nfixa	Fig. 3 from Pistocchi et al., 2013
thigmotaxis decreased process quality, abnormal	AB + MO1-nfixa	Fig. S6 from Taglietti et al., 2016 Fig. SMovie2 from Pistocchi et al., 2013
whole organism dead, abnormal	AB + MO1-nfixa	text only from Pistocchi et al., 2013
whole organism decreased mobility, abnormal	AB + MO1-nfixa	Fig. SMovie2 from Pistocchi et al., 2013

Phenotype of all Fish created by or utilizing MO1-nfixa

Phenotype	Fish	Conditions	Figures
muscle cell proliferation increased occurrence, abnormal	AB + MO1-nfixa	standard conditions	Fig. 6 from Pistocchi et al., 2013
swimming behavior disrupted, abnormal	AB + MO1-nfixa	standard conditions	Fig. 3 from Pistocchi et al., 2013
skeletal muscle myofibril disorganized, abnormal	AB + MO1-nfixa	standard conditions	Fig. 3 from Pistocchi et al., 2013
whole organism decreased mobility, abnormal	AB + MO1-nfixa	standard conditions	Fig. SMovie2 from Pistocchi et al., 2013
muscle has fewer parts of type muscle cell sarcoplasmic reticulum, abnormal	AB + MO1-nfixa	standard conditions	Fig. 3 from Pistocchi et al., 2013
skeletal muscle fiber development disrupted, abnormal	AB + MO1-nfixa	standard conditions	Fig. 6 from Pistocchi et al., 2013
swimming decreased process quality, abnormal	AB + MO1-nfixa	standard conditions	Fig. S6 from Taglietti et al., 2016
whole organism dead, abnormal	AB + MO1-nfixa	standard conditions	text only from Pistocchi et al., 2013
thigmotaxis decreased process quality, abnormal	AB + MO1-nfixa	standard conditions	Fig. S6 from Taglietti et al., 2016 Fig. SMovie2 from Pistocchi et al., 2013
muscle precursor cell decreased amount, abnormal	WT + MO1-nfixa	standard conditions	Fig. 7 from Pistocchi et al., 2013
slow muscle cell decreased amount, abnormal	AB + MO1-nfatc4 + MO1-nfixa	standard conditions	Fig. 5 from Pistocchi et al., 2013
thigmotaxis decreased process quality, abnormal	AB + MO1-nfixa + MO1-sox6	standard conditions	Fig. S6 from Taglietti et al., 2016
whole organism ab-f59 labeling increased amount, abnormal	AB + MO1-nfixa + MO1-sox6	standard conditions	Fig. 6 from Taglietti et al., 2016
swimming decreased process quality, abnormal	AB + MO1-nfixa + MO1-sox6	standard conditions	Fig. S6 from Taglietti et al., 2016
whole organism smyhc1 expression increased amount, abnormal	AB + MO1-nfixa + MO1-sox6	standard conditions	Fig. 6 from Taglietti et al., 2016

Citations