Morpholino

MO1-aggf1

ID
ZDB-MRPHLNO-130320-1
Name
MO1-aggf1
Previous Names
None
Target
Sequence
5' - GCCCTGCTCACCTGCTGTCGGAGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-aggf1
No data available
Phenotype
Phenotype resulting from MO1-aggf1
Phenotype Fish Figures
angioblast cell differentiation process quality, abnormal AB + MO1-aggf1 Fig. 3 from Li et al., 2014
angioblastic mesenchymal cell tal1 expression decreased amount, abnormal WT + MO1-aggf1 Fig. 7 from Wang et al., 2017
caudal vein absent, abnormal y1Tg + MO1-aggf1 Fig. 4 with image from Kashiwada et al., 2015
caudal vein malformed, abnormal y1Tg + MO1-aggf1 Fig. 4 with image from Kashiwada et al., 2015
caudal vein plexus apoptotic process increased process quality, abnormal ncv13Tg; ubs4Tg + MO1-aggf1 Fig. 4 with image from Kashiwada et al., 2015
definitive hemopoiesis process quality, abnormal AB + MO1-aggf1 Fig. 2 from Li et al., 2014
dorsal longitudinal anastomotic vessel immature, abnormal AB + MO1-aggf1 Fig. 4 from Chen et al., 2013
dorsal longitudinal anastomotic vessel morphology, abnormal la116Tg + MO1-aggf1 Fig. 4 from Chen et al., 2013
granulocyte monocyte progenitor cell mpx expression decreased amount, abnormal WT + MO1-aggf1 Fig. 7 from Wang et al., 2017
hemangioblast cell differentiation process quality, abnormal AB + MO1-aggf1 Fig. 3 from Li et al., 2014
hematopoietic stem cell differentiation process quality, abnormal AB + MO1-aggf1 Fig. 3 from Li et al., 2014
intersegmental vessel morphology, abnormal la116Tg + MO1-aggf1 Fig. 4 from Chen et al., 2013
lymphangioblast cord cell decreased amount, abnormal AB + MO1-aggf1 Fig. 4 from Chen et al., 2013
mid cerebral vein immature, abnormal AB + MO1-aggf1 Fig. S8 from Chen et al., 2013
nucleate erythrocyte decreased amount, abnormal AB + MO1-aggf1 Fig. 1 from Li et al., 2014
posterior cardinal vein absent, abnormal la116Tg + MO1-aggf1 Fig. 5 from Chen et al., 2013
primitive hemopoiesis process quality, abnormal AB + MO1-aggf1 Fig. 1 from Li et al., 2014
subintestinal vein absent, abnormal AB + MO1-aggf1 Fig. 4 from Chen et al., 2013
Phenotype of all Fish created by or utilizing MO1-aggf1
Phenotype Fish Conditions Figures
hemangioblast cell differentiation process quality, abnormal AB + MO1-aggf1 control Fig. 3 from Li et al., 2014
nucleate erythrocyte decreased amount, abnormal AB + MO1-aggf1 control Fig. 1 from Li et al., 2014
definitive hemopoiesis process quality, abnormal AB + MO1-aggf1 control Fig. 2 from Li et al., 2014
lymphangioblast cord cell decreased amount, abnormal AB + MO1-aggf1 standard conditions Fig. 4 from Chen et al., 2013
primitive hemopoiesis process quality, abnormal AB + MO1-aggf1 control Fig. 1 from Li et al., 2014
hematopoietic stem cell differentiation process quality, abnormal AB + MO1-aggf1 control Fig. 3 from Li et al., 2014
subintestinal vein absent, abnormal AB + MO1-aggf1 standard conditions Fig. 4 from Chen et al., 2013
mid cerebral vein immature, abnormal AB + MO1-aggf1 standard conditions Fig. S8 from Chen et al., 2013
dorsal longitudinal anastomotic vessel immature, abnormal AB + MO1-aggf1 standard conditions Fig. 4 from Chen et al., 2013
angioblast cell differentiation process quality, abnormal AB + MO1-aggf1 control Fig. 3 from Li et al., 2014
granulocyte monocyte progenitor cell mpx expression decreased amount, abnormal WT + MO1-aggf1 standard conditions Fig. 7 from Wang et al., 2017
angioblastic mesenchymal cell tal1 expression decreased amount, abnormal WT + MO1-aggf1 standard conditions Fig. 7 from Wang et al., 2017
posterior cardinal vein absent, abnormal la116Tg + MO1-aggf1 standard conditions Fig. 5 from Chen et al., 2013
intersegmental vessel morphology, abnormal la116Tg + MO1-aggf1 standard conditions Fig. 4 from Chen et al., 2013
dorsal longitudinal anastomotic vessel morphology, abnormal la116Tg + MO1-aggf1 standard conditions Fig. 4 from Chen et al., 2013
caudal vein malformed, abnormal y1Tg + MO1-aggf1 standard conditions Fig. 4 with image from Kashiwada et al., 2015
caudal vein absent, abnormal y1Tg + MO1-aggf1 standard conditions Fig. 4 with image from Kashiwada et al., 2015
caudal vein plexus apoptotic process increased process quality, abnormal ncv13Tg; ubs4Tg + MO1-aggf1 standard conditions Fig. 4 with image from Kashiwada et al., 2015
Citations