Morpholino

MO3-lamc1

ID

ZDB-MRPHLNO-130305-2

Name

MO3-lamc1

Previous Names

None

Target

Sequence

5' - TGTGCCTTTTGCTATTGCGACCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This morpholino is missing one nt (T).

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-lamc1

No data available

Phenotype

Phenotype resulting from MO3-lamc1

Phenotype	Fish	Figures
fast muscle cell myosin filament disorganized, abnormal	WT + MO3-lamc1	Fig. 6 , Fig. S1 from Snow et al., 2008
fast muscle myoblast decreased length, abnormal	WT + MO3-lamc1	Fig. 6 from Snow et al., 2008
muscle cell migration disrupted, abnormal	WT + MO3-lamc1	Fig. S1 from Snow et al., 2008
myotome shape, abnormal	WT + MO3-lamc1	Fig. S1 from Snow et al., 2008
skeletal muscle fiber development disrupted, abnormal	WT + MO3-lamc1	Fig. 6 , Fig. S1 from Snow et al., 2008
slow muscle cell myosin filament disorganized, abnormal	WT + MO3-lamc1	Fig. S1 from Snow et al., 2008

Phenotype of all Fish created by or utilizing MO3-lamc1

Phenotype	Fish	Conditions	Figures
whole organism Ab1-mmp11 labeling decreased amount, abnormal	AB + MO2-lamc1 + MO3-lamc1	control	Fig. 3 from Jenkins et al., 2016
notochord formation disrupted, abnormal	WT + MO2-lamc1 + MO3-lamc1	standard conditions	Fig. 3 from Parsons et al., 2002
notochord undifferentiated, abnormal	WT + MO2-lamc1 + MO3-lamc1	standard conditions	Fig. 3 from Parsons et al., 2002
whole organism decreased length, abnormal	WT + MO2-lamc1 + MO3-lamc1	standard conditions	Fig. 3 from Parsons et al., 2002
fast muscle myoblast decreased length, abnormal	WT + MO3-lamc1	standard conditions	Fig. 6 from Snow et al., 2008
fast muscle cell decreased length, abnormal	WT + MO3-lamc1	chemical treatment: Cyclopamine	Fig. 2 from Peterson et al., 2010
fast muscle cell circular, abnormal	WT + MO3-lamc1	chemical treatment: Cyclopamine	Fig. 2 from Peterson et al., 2010
skeletal muscle fiber development disrupted, abnormal	WT + MO3-lamc1	standard conditions	Fig. 6 , Fig. S1 from Snow et al., 2008
slow muscle cell myosin filament disorganized, abnormal	WT + MO3-lamc1	standard conditions	Fig. S1 from Snow et al., 2008
muscle cell migration disrupted, abnormal	WT + MO3-lamc1	standard conditions	Fig. S1 from Snow et al., 2008
fast muscle cell myosin filament disorganized, abnormal	WT + MO3-lamc1	standard conditions	Fig. 6 , Fig. S1 from Snow et al., 2008
myotome shape, abnormal	WT + MO3-lamc1	standard conditions	Fig. S1 from Snow et al., 2008

Citations