Morpholino

MO1-adgrl3.1

ID
ZDB-MRPHLNO-130110-3
Name
MO1-adgrl3.1
Previous Names
None
Target
Sequence
5' - ATGTGAGTGTATCTCTGTACCTGAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adgrl3.1
Phenotype
Phenotype resulting from MO1-adgrl3.1
Phenotype of all Fish created by or utilizing MO1-adgrl3.1
Phenotype Fish Conditions Figures
locomotory behavior increased occurrence, abnormal AB + MO1-adgrl3.1 chemical treatment by environment: paracetamol Fig. S2 from Reuter et al., 2016
swimming behavior increased occurrence, abnormal AB + MO1-adgrl3.1 chemical treatment by environment: paracetamol Fig. S2 from Reuter et al., 2016
swimming behavior process quality, abnormal AB/EKW + MO1-adgrl3.1 standard conditions Fig. 2 from Lange et al., 2012
caudal tuberculum dopaminergic neuron mislocalised, abnormal AB/EKW + MO1-adgrl3.1 standard conditions Fig. 3 from Lange et al., 2012
locomotion increased speed, abnormal AB/EKW + MO1-adgrl3.1 standard conditions Fig. 2 from Lange et al., 2012
whole organism increased behavioural activity, abnormal AB/EKW + MO1-adgrl3.1 standard conditions Fig. 1 from Lange et al., 2012
locomotion increased occurrence, abnormal AB/EKW + MO1-adgrl3.1 standard conditions Fig. S6 from Lange et al., 2012
caudal tuberculum dopaminergic neuron decreased amount, abnormal AB/EKW + MO1-adgrl3.1 standard conditions Fig. 3 from Lange et al., 2012
caudal tuberculum neuron disorganized, abnormal AB/EKW + MO1-adgrl3.1 standard conditions Fig. 3 from Lange et al., 2012
locomotory behavior increased process quality, abnormal AB/EKW + MO1-adgrl3.1 standard conditions Fig. 1Fig. S6 from Lange et al., 2012
locomotion decreased occurrence, abnormal WT + MO1-adgrl3.1 chemical treatment by environment: eticlopride(1+) Fig. 3 from Lange et al., 2018
locomotion occurrence, ameliorated WT + MO1-adgrl3.1 chemical treatment by environment: quinpirole Fig. 2 from Lange et al., 2018
locomotion increased occurrence, exacerbated WT + MO1-adgrl3.1 chemical treatment by environment: haloperidol Fig. 3 from Lange et al., 2018
locomotion increased occurrence, abnormal WT + MO1-adgrl3.1 chemical treatment by environment: SKF 38393 Fig. 2 from Lange et al., 2018
locomotion decreased occurrence, abnormal WT + MO1-adgrl3.1 standard conditions Fig. 2 from Lange et al., 2018
locomotion decreased occurrence, abnormal WT + MO1-adgrl3.1 chemical treatment by environment: SCH 23390 Fig. 3 from Lange et al., 2018
locomotion occurrence, ameliorated WT + MO1-adgrl3.1 chemical treatment by environment: apomorphine Fig. 2 from Lange et al., 2018
Citations