Morpholino

MO1-kcnh1a

ID

ZDB-MRPHLNO-121127-4

Name

MO1-kcnh1a

Previous Names

kcnh1a ATG (1)

Target

kcnh1a (1)

Sequence

5' - CACGGCGGGTCATGCGCTCCACTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-kcnh1a

No data available

Phenotype

Phenotype resulting from MO1-kcnh1a

Phenotype	Fish	Figures
axis elongation disrupted, abnormal	AB/TU + MO1-kcnh1a	Fig. 6 from Stengel et al., 2012
brain hydrocephalic, abnormal	AB/TU + MO1-kcnh1a	Fig. 5 from Stengel et al., 2012
cell detached from post-vent region, abnormal	AB/TU + MO1-kcnh1a	Fig. 5 from Stengel et al., 2012
embryo development disrupted, abnormal	AB/TU + MO1-kcnh1a	Fig. 5 from Stengel et al., 2012
EVL constricted, abnormal	AB/TU + MO1-kcnh1a	Fig. 5 from Stengel et al., 2012
extension morphology, abnormal	AB/TU + MO1-kcnh1a	Fig. 5 from Stengel et al., 2012
eye immature, abnormal	AB/TU + MO1-kcnh1a	Fig. 5 from Stengel et al., 2012
heart edematous, abnormal	AB/TU + MO1-kcnh1a	Fig. 5 from Stengel et al., 2012
hindbrain development delayed, abnormal	AB/TU + MO1-kcnh1a	Fig. 6 from Stengel et al., 2012
post-vent region kinked, abnormal	AB/TU + MO1-kcnh1a	Fig. 5 from Stengel et al., 2012
post-vent region necrotic, abnormal	AB/TU + MO1-kcnh1a	Fig. 5 from Stengel et al., 2012
rhombomere 3 decreased thickness, abnormal	AB/TU + MO1-kcnh1a	Fig. 6 from Stengel et al., 2012
rhombomere 5 decreased thickness, abnormal	AB/TU + MO1-kcnh1a	Fig. 6 from Stengel et al., 2012
somite border inconspicuous, abnormal	AB/TU + MO1-kcnh1a	Fig. 6 from Stengel et al., 2012
whole organism dead, abnormal	AB/TU + MO1-kcnh1a	Fig. 5 from Stengel et al., 2012

Phenotype of all Fish created by or utilizing MO1-kcnh1a

Phenotype	Fish	Conditions	Figures
eye immature, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 5 from Stengel et al., 2012
embryo development disrupted, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 5 from Stengel et al., 2012
extension morphology, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 5 from Stengel et al., 2012
hindbrain development delayed, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 6 from Stengel et al., 2012
somite border inconspicuous, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 6 from Stengel et al., 2012
axis elongation disrupted, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 6 from Stengel et al., 2012
heart edematous, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 5 from Stengel et al., 2012
cell detached from post-vent region, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 5 from Stengel et al., 2012
rhombomere 3 decreased thickness, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 6 from Stengel et al., 2012
whole organism dead, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 5 from Stengel et al., 2012
post-vent region necrotic, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 5 from Stengel et al., 2012
brain hydrocephalic, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 5 from Stengel et al., 2012
post-vent region kinked, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 5 from Stengel et al., 2012
rhombomere 5 decreased thickness, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 6 from Stengel et al., 2012
EVL constricted, abnormal	AB/TU + MO1-kcnh1a	standard conditions	Fig. 5 from Stengel et al., 2012

Citations