ZFIN ID: ZDB-MRPHLNO-121105-1
Morpholino Name: MO1-bmi1a
Target: bmi1a (1)
Sequence:
5' - TGCATCGTCATGGGATAGAAAAGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-bmi1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-bmi1a
Expressed Gene Anatomy Figures
hbae1.1 Fig. 7 from Zhou et al., 2011
PHENOTYPE
Phenotype resulting from MO1-bmi1a
No data available

Phenotype of all Fish created by or utilizing MO1-bmi1a
No data available
OTHER MO1-bmi1a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)