Morpholino

MO2-flncb

ID
ZDB-MRPHLNO-121018-1
Name
MO2-flncb
Previous Names
None
Target
Sequence
5' - GAGTTTTCTAATGGCCCTTACCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-flncb
No data available
Phenotype
Phenotype resulting from MO2-flncb
Phenotype Fish Figures
atrium elongated, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
blood circulation arrested, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. SVideo3 from Begay et al., 2016
blood circulation disrupted, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. SVideo3 from Begay et al., 2016
cardiac muscle cell vacuolated, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
cardiac muscle cell autophagosome present, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
cardiac muscle cell development disrupted, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
cardiac ventricle truncated, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
heart decreased functionality, abnormal WT + MO2-flncb + MO4-tp53 Fig. 5 from Begay et al., 2016
heart cardiac myofibril disorganized, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
heart Z disc disorganized, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
heart contraction decreased rate, abnormal WT + MO2-flncb + MO4-tp53 Fig. 5 from Begay et al., 2016
heart looping disrupted, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
pericardium edematous, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
sarcomere organization disrupted, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
slow muscle cell broken, abnormal WT + MO2-flncb Fig. 2 from Ruparelia et al., 2012
whole organism dead, abnormal WT + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
whole organism decreased life span, abnormal WT + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
Phenotype of all Fish created by or utilizing MO2-flncb
Phenotype Fish Conditions Figures
slow muscle cell broken, abnormal WT + MO2-flncb standard conditions Fig. 2 from Ruparelia et al., 2012
sarcomere organization disrupted, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
whole organism decreased life span, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
cardiac muscle cell development disrupted, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
heart decreased functionality, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 5 from Begay et al., 2016
heart contraction decreased rate, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 5 from Begay et al., 2016
cardiac muscle cell vacuolated, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
pericardium edematous, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
heart cardiac myofibril disorganized, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
heart Z disc disorganized, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
whole organism dead, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
cardiac muscle cell autophagosome present, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
heart looping disrupted, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
blood circulation arrested, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. SVideo3 from Begay et al., 2016
cardiac ventricle truncated, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
pericardium edematous, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
atrium elongated, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
blood circulation disrupted, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. SVideo3 from Begay et al., 2016
somite border myosin complex aggregated, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 7 from Ruparelia et al., 2012
slow muscle cell myosin filament irregular spatial pattern, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 7 from Ruparelia et al., 2012
slow muscle cell actin filament irregular spatial pattern, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 7 from Ruparelia et al., 2012
skeletal muscle cell ab-a4.1025 labeling spatial pattern, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 3,  Fig. 4 from Ruparelia et al., 2016
slow muscle cell broken, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 4,  Fig. 5 from Ruparelia et al., 2012
skeletal muscle cell broken, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 3,  Fig. 4 from Ruparelia et al., 2016
slow muscle cell type III intermediate filament irregular spatial pattern, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 7 from Ruparelia et al., 2012
striated muscle cell muscle myosin complex accumulation myoseptum, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 3 from Ruparelia et al., 2016
somite border ab-a4.1025 labeling mislocalised, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 3,  Fig. 4 from Ruparelia et al., 2016
muscle cell cellular homeostasis disrupted, abnormal WT + MO1-flnca + MO2-flncb standard conditions text only from Ruparelia et al., 2012
slow muscle cell non-functional, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 4 from Ruparelia et al., 2012
fast muscle cell contractile muscle fiber disassembled, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 5 from Ruparelia et al., 2012
striated muscle cell mitochondrion infiltrative, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 3 from Ruparelia et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.