Morpholino

MO2-flncb

ID
ZDB-MRPHLNO-121018-1
Name
MO2-flncb
Previous Names
None
Target
Sequence
5' - GAGTTTTCTAATGGCCCTTACCTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-flncb
No data available
Phenotype
Phenotype resulting from MO2-flncb
Phenotype Fish Figures
atrium elongated, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
blood circulation arrested, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. SVideo3 from Begay et al., 2016
blood circulation disrupted, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. SVideo3 from Begay et al., 2016
cardiac muscle cell vacuolated, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
cardiac muscle cell autophagosome present, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
cardiac muscle cell development disrupted, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
cardiac ventricle truncated, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
heart decreased functionality, abnormal WT + MO2-flncb + MO4-tp53 Fig. 5 from Begay et al., 2016
heart cardiac myofibril disorganized, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
heart Z disc disorganized, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
heart contraction decreased rate, abnormal WT + MO2-flncb + MO4-tp53 Fig. 5 from Begay et al., 2016
heart looping disrupted, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
pericardium edematous, abnormal f1Tg + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
sarcomere organization disrupted, abnormal WT + MO2-flncb + MO4-tp53 Fig. 6 with image from Begay et al., 2016
slow muscle cell broken, abnormal WT + MO2-flncb Fig. 2 from Ruparelia et al., 2012
whole organism dead, abnormal WT + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
whole organism decreased life span, abnormal WT + MO2-flncb + MO4-tp53 Fig. 4 with image from Begay et al., 2016
Phenotype of all Fish created by or utilizing MO2-flncb
Phenotype Fish Conditions Figures
slow muscle cell broken, abnormal WT + MO2-flncb standard conditions Fig. 2 from Ruparelia et al., 2012
sarcomere organization disrupted, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
whole organism decreased life span, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
cardiac muscle cell development disrupted, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
heart decreased functionality, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 5 from Begay et al., 2016
heart contraction decreased rate, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 5 from Begay et al., 2016
cardiac muscle cell vacuolated, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
pericardium edematous, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
heart cardiac myofibril disorganized, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
heart Z disc disorganized, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
whole organism dead, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
cardiac muscle cell autophagosome present, abnormal WT + MO2-flncb + MO4-tp53 standard conditions Fig. 6 with image from Begay et al., 2016
heart looping disrupted, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
blood circulation arrested, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. SVideo3 from Begay et al., 2016
cardiac ventricle truncated, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
pericardium edematous, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
atrium elongated, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. 4 with image from Begay et al., 2016
blood circulation disrupted, abnormal f1Tg + MO2-flncb + MO4-tp53 standard conditions Fig. SVideo3 from Begay et al., 2016
pericardium edematous, abnormal WT + MO1-flnca + MO2-flncb control Fig. 3 with image from Wu et al., 2025
cellular respiration decreased process quality, abnormal WT + MO1-flnca + MO2-flncb control Fig. 6 with image from Wu et al., 2025
somite border myosin complex aggregated, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 7 from Ruparelia et al., 2012
slow muscle cell myosin filament irregular spatial pattern, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 7 from Ruparelia et al., 2012
whole organism gata2a expression increased amount, abnormal WT + MO1-flnca + MO2-flncb control Fig. 3 with image from Wu et al., 2025
slow muscle cell actin filament irregular spatial pattern, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 7 from Ruparelia et al., 2012
skeletal muscle cell ab-a4.1025 labeling spatial pattern, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 3Fig. 4 from Ruparelia et al., 2016
slow muscle cell broken, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 4Fig. 5 from Ruparelia et al., 2012
whole organism nppa expression increased amount, abnormal WT + MO1-flnca + MO2-flncb control Fig. 3 with image from Wu et al., 2025
skeletal muscle cell broken, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 3Fig. 4 from Ruparelia et al., 2016
whole organism Ab2-ndufa9 labeling decreased amount, abnormal WT + MO1-flnca + MO2-flncb control Fig. 6 with image from Wu et al., 2025
slow muscle cell type III intermediate filament irregular spatial pattern, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 7 from Ruparelia et al., 2012
heart contraction decreased rate of continuous process, abnormal WT + MO1-flnca + MO2-flncb control Fig. 3 with image from Wu et al., 2025
striated muscle cell muscle myosin complex accumulation myoseptum, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 3 from Ruparelia et al., 2016
somite border ab-a4.1025 labeling mislocalised, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 3Fig. 4 from Ruparelia et al., 2016
whole organism dnm1l expression increased amount, abnormal WT + MO1-flnca + MO2-flncb control Fig. 5 with image from Wu et al., 2025
whole organism opa1 expression increased amount, abnormal WT + MO1-flnca + MO2-flncb control Fig. 5 with image from Wu et al., 2025
swimming decreased process quality, abnormal WT + MO1-flnca + MO2-flncb control Fig. 3 with image from Wu et al., 2025
muscle cell cellular homeostasis disrupted, abnormal WT + MO1-flnca + MO2-flncb standard conditions text only from Ruparelia et al., 2012
skeletal muscle cell mitochondrion increased size, abnormal WT + MO1-flnca + MO2-flncb control Fig. 4 with image from Wu et al., 2025
post-vent region curved, abnormal WT + MO1-flnca + MO2-flncb control Fig. 3 with image from Wu et al., 2025
slow muscle cell non-functional, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 4 from Ruparelia et al., 2012
fast muscle cell contractile muscle fiber disassembled, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 5 from Ruparelia et al., 2012
skeletal muscle cell mitochondrion increased area, abnormal WT + MO1-flnca + MO2-flncb control Fig. 4 with image from Wu et al., 2025
whole organism Ab4-dnm1l labeling decreased amount, abnormal WT + MO1-flnca + MO2-flncb control Fig. 5 with image from Wu et al., 2025
striated muscle cell mitochondrion infiltrative, abnormal WT + MO1-flnca + MO2-flncb standard conditions Fig. 3 from Ruparelia et al., 2016
whole organism Ab1-flnc labeling decreased amount, abnormal WT + MO1-flnca + MO2-flncb control Fig. 5 with image from Wu et al., 2025
trunk musculature skeletal muscle cell damaged, abnormal WT + MO1-flnca + MO2-flncb control Fig. 3 with image from Wu et al., 2025
Citations