Morpholino
MO1-mir142
- ID
- ZDB-MRPHLNO-121016-1
- Name
- MO1-mir142
- Previous Names
-
- dre-miR-142a-3p MO
- Targets
- Sequence
-
5' - TCCATAAAGTAGGAAACACTACA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This MO targets both mir-142a and mir142b
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir142
Expressed Gene | Anatomy | Figures |
---|---|---|
actc1b |
Fig. 4
from Nishiyama et al., 2012 |
|
bmp2b |
Fig. 4
from Nishiyama et al., 2012 |
|
cdh5 |
Fig. 7
from Lalwani et al., 2012 |
|
cmlc1 |
Fig. 4
from Nishiyama et al., 2012 |
|
gata1a |
Fig. 4
from Nishiyama et al., 2012 |
|
gata2a |
Fig. 4
from Nishiyama et al., 2012 |
|
hbaa1 |
Fig. 4
from Nishiyama et al., 2012 |
|
hbbe1.1 |
Fig. 4
from Nishiyama et al., 2012 |
|
myf5 |
Fig. 4
from Nishiyama et al., 2012 |
|
myh7 |
Fig. 4
from Nishiyama et al., 2012 |
|
myod1 |
Fig. 4
from Nishiyama et al., 2012 |
|
rock2a |
Fig. 4
from Nishiyama et al., 2012 |
|
spi1b |
Fig. 4
from Nishiyama et al., 2012 |
|
tal1 |
Fig. 4
from Nishiyama et al., 2012 |
|
tbx16 |
Fig. 4
from Nishiyama et al., 2012 |
|
tbxta |
Fig. 4
from Nishiyama et al., 2012 |
|
tdgf1 |
Fig. 4
from Nishiyama et al., 2012 |
|
tnnt3b |
Fig. 4
from Nishiyama et al., 2012 |
Phenotype
Phenotype resulting from MO1-mir142
No data available
Phenotype of all Fish created by or utilizing MO1-mir142
Citations