Morpholino

MO1-pomgnt2

ID

ZDB-MRPHLNO-121005-1

Name

MO1-pomgnt2

Previous Names

gtdc2Start (1)
MO1-gtdc2

Target

pomgnt2 (1)

Sequence

5' - CCGGCAGGTTCATCCTACACCCGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pomgnt2

No data available

Phenotype

Phenotype resulting from MO1-pomgnt2

Phenotype	Fish	Figures
brain decreased volume, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012
eye aplastic, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012
eye hypoplastic, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012
head decreased size, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012
head hydrocephalic, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012
muscle myofibril disorganized, abnormal	WT + MO1-pomgnt2	Fig. 3, Fig. S3 from Manzini et al., 2012
muscle tissue development disrupted, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012
post-vent region bent, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012
post-vent region increased thickness, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012
retinal pigmented epithelium disorganized, abnormal	WT + MO1-pomgnt2	Fig. S3 from Manzini et al., 2012
somite U-shaped, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012
ventricular system hemorrhagic, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012
whole organism dead, abnormal	WT + MO1-pomgnt2	Fig. S3 from Manzini et al., 2012
whole organism decreased length, abnormal	WT + MO1-pomgnt2	Fig. 3, Fig. S3 from Manzini et al., 2012
whole organism decreased mobility, abnormal	WT + MO1-pomgnt2	Fig. 3 from Manzini et al., 2012

Phenotype of all Fish created by or utilizing MO1-pomgnt2

Phenotype	Fish	Conditions	Figures
muscle tissue development disrupted, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012
whole organism dead, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. S3 from Manzini et al., 2012
brain decreased volume, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012
retinal pigmented epithelium disorganized, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. S3 from Manzini et al., 2012
whole organism decreased mobility, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012
muscle myofibril disorganized, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3, Fig. S3 from Manzini et al., 2012
head hydrocephalic, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012
eye hypoplastic, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012
head decreased size, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012
ventricular system hemorrhagic, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012
eye aplastic, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012
post-vent region increased thickness, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012
post-vent region bent, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012
whole organism decreased length, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3, Fig. S3 from Manzini et al., 2012
somite U-shaped, abnormal	WT + MO1-pomgnt2	standard conditions	Fig. 3 from Manzini et al., 2012

Citations