Morpholino

MO1-mir430a

ID
ZDB-MRPHLNO-120921-4
Name
MO1-mir430a
Previous Names
  • antiā€“miR-430 KD (1)
Targets
Sequence
5' - ACTACCCCAACAAATAGCACTTACC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 6 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir430a
Expressed Gene Anatomy Figures
smarca2 Fig. 5 from Laue et al., 2019
Phenotype
Phenotype resulting from MO1-mir430a
No data available
Phenotype of all Fish created by or utilizing MO1-mir430a
Phenotype Fish Conditions Figures
whole organism ab24-h3 labeling decreased amount, abnormal WT + MO1-mir430a control Fig. 4 from Laue et al., 2019
pericardium edematous, abnormal WT + MO1-mir430a standard conditions text only from Ghani et al., 2011
brain morphology, abnormal WT + MO1-mir430a standard conditions text only from Ghani et al., 2011
whole organism smarca2 expression increased amount, abnormal WT + MO1-mir430a standard conditions Fig. 5 from Laue et al., 2019
heart morphology, abnormal WT + MO1-mir430a standard conditions text only from Ghani et al., 2011
forerunner cell group sox17 expression decreased amount, abnormal WT + MO1-mir430a + MO1-mir430c + MO4-mir430 standard conditions Fig. 4 with image from Fischer et al., 2019
forerunner cell group decreased size, abnormal WT + MO1-mir430a + MO1-mir430c + MO4-mir430 standard conditions Fig. 4 with image from Fischer et al., 2019
axial mesoderm foxa2 expression decreased amount, abnormal WT + MO1-mir430a + MO1-mir430c + MO4-mir430 standard conditions Fig. 4 with image from Fischer et al., 2019
forerunner cell group sox17 expression decreased amount, abnormal foxh1m768/m768 + MO1-mir430a + MO1-mir430c + MO4-mir430 standard conditions Fig. 4 with image from Fischer et al., 2019
axial mesoderm foxa2 expression decreased amount, abnormal foxh1m768/m768 + MO1-mir430a + MO1-mir430c + MO4-mir430 standard conditions Fig. 4 with image from Fischer et al., 2019
forerunner cell group decreased size, abnormal foxh1m768/m768 + MO1-mir430a + MO1-mir430c + MO4-mir430 standard conditions Fig. 4 with image from Fischer et al., 2019
Citations