Morpholino
MO2-mir146a
- ID
- ZDB-MRPHLNO-120921-2
- Name
- MO2-mir146a
- Previous Names
-
- loopstar: dre-mir-146a (1)
- Target
- Sequence
-
5' - GAGCCCATAGATGAACTTTTCATGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mir146a
No data available
Phenotype
Phenotype resulting from MO2-mir146a
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-mir146a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| macrophage decreased amount, abnormal | WT + MO2-mir146a | standard conditions |
Fig. 6
from Ghani et al., 2011 |
| myeloid leukocyte decreased amount, abnormal | WT + MO2-mir146a | standard conditions |
Fig. 6
from Ghani et al., 2011 |
1 - 2 of 2
Citations
- Ordas, A., Kanwal, Z., Lindenberg, V., Rougeot, J., Mink, M., Spaink, H.P., and Meijer, A.H. (2013) MicroRNA-146 function in the innate immune transcriptome response of zebrafish embryos to Salmonella typhimurium infection. BMC Genomics. 14(1):696
- Ghani, S., Riemke, P., Schönheit, J., Lenze, D., Stumm, J., Hoogenkamp, M., Lagendijk, A., Heinz, S., Bonifer, C., Bakkers, J., Abdelilah-Seyfried, S., Hummel, M., and Rosenbauer, F. (2011) Macrophage development from hematopoietic stem cells requires PU.1 coordinated microRNA expression. Blood. 118(8):2275-84
1 - 2 of 2
Show