Morpholino

MO2-hdac4

ID
ZDB-MRPHLNO-120905-4
Name
MO2-hdac4
Previous Names
  • exon-10 to intron-10 (1)
Target
Sequence
5' - AGAGCCACAGAGGAGCTGCTTTACC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-hdac4
No data available
Phenotype
Phenotype resulting from MO2-hdac4
No data available
Phenotype of all Fish created by or utilizing MO2-hdac4
Phenotype Fish Conditions Figures
trabecula communis hypoplastic, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
head anterior-most region shortened, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
cranial neural crest antero-ventral region lacks all parts of type cranial neural crest cell, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 6 with image from Delaurier et al., 2012
head anterior-most region decreased size, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
head anterior-most region antero-posteriorly flattened, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
trabecula cranii decreased length, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
ethmoid cartilage perforate, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with imageFig. 3 with image from Delaurier et al., 2012
ethmoid cartilage hypoplastic, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with imageFig. 6 with image from Delaurier et al., 2012
ethmoid cartilage deformed, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 6 with image from Delaurier et al., 2012
ethmoid cartilage morphology, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 3 with image from Delaurier et al., 2012
trabecula communis deformed, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 6 with image from Delaurier et al., 2012
ethmoid cartilage shortened, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
palate cleft, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with imageFig. 3 with image from Delaurier et al., 2012
ethmoid cartilage notched, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with image from Delaurier et al., 2012
ethmoid cartilage decreased width, abnormal AB + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 2 with imageFig. 6 with image from Delaurier et al., 2012
cranial neural crest medial region has fewer parts of type cranial neural crest cell, abnormal ba2Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 5 with image from Delaurier et al., 2012
neural crest cell migration disrupted, abnormal ba2Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 5 with image from Delaurier et al., 2012
cranial neural crest morphology, abnormal ba2Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 5 with image from Delaurier et al., 2012
ethmoid cartilage hypoplastic, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
ethmoid cartilage notched, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
ethmoid cartilage perforate, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
ethmoid cartilage decreased width, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
trabecula communis hypoplastic, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
ethmoid cartilage shortened, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
trabecula communis aplastic, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
trabecula cranii decreased length, abnormal sox9azc81Tg + MO1-hdac4 + MO2-hdac4 standard conditions Fig. 7 with image from Delaurier et al., 2012
Citations