Morpholino

MO1-smyd2a

ID
ZDB-MRPHLNO-120824-1
Name
MO1-smyd2a
Previous Names
  • 5 prime UTR MO (1)
Target
Sequence
5' - ATCGCTATTGACCTGCTGCTCGCGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smyd2a
No data available
Phenotype
Phenotype resulting from MO1-smyd2a
Phenotype Fish Figures
atrium malformed, abnormal WT + MO1-smyd2a Fig. 5,  text only from Voelkel et al., 2013
cardiac ventricle malformed, abnormal WT + MO1-smyd2a Fig. 5,  text only from Voelkel et al., 2013
heart decreased contractility, abnormal WT + MO1-smyd2a Fig. 5 from Voelkel et al., 2013
heart decreased functionality, abnormal WT + MO1-smyd2a Fig. 5 from Voelkel et al., 2013
heart decreased thickness, abnormal WT + MO1-smyd2a text only from Voelkel et al., 2013
heart elongated, abnormal WT + MO1-smyd2a text only from Voelkel et al., 2013
Fig. 5 from Donlin et al., 2012
heart contraction decreased rate, abnormal WT + MO1-smyd2a text only from Voelkel et al., 2013
text only from Donlin et al., 2012
heart development disrupted, abnormal WT + MO1-smyd2a Fig. 5 from Donlin et al., 2012
pericardium edematous, abnormal WT + MO1-smyd2a text only from Voelkel et al., 2013
Fig. 5 from Donlin et al., 2012
post-vent region increased curvature, abnormal WT + MO1-smyd2a Fig. 5 from Donlin et al., 2012
sarcomere organization disrupted, abnormal WT + MO1-smyd2a Fig. 5 from Donlin et al., 2012
sinus venosus edematous, abnormal WT + MO1-smyd2a text only from Voelkel et al., 2013
Fig. 5 from Donlin et al., 2012
skeletal muscle morphology, abnormal WT + MO1-smyd2a text only from Voelkel et al., 2013
skeletal muscle cell disorganized, abnormal WT + MO1-smyd2a Fig. 5 from Donlin et al., 2012
skeletal muscle cell I band disorganized, abnormal WT + MO1-smyd2a Fig. 5 from Donlin et al., 2012
skeletal muscle cell sarcomere disorganized, abnormal WT + MO1-smyd2a Fig. 5 from Donlin et al., 2012
skeletal muscle cell Z disc disorganized, abnormal WT + MO1-smyd2a Fig. 5 from Donlin et al., 2012
skeletal muscle tissue development disrupted, abnormal WT + MO1-smyd2a Fig. 5 from Donlin et al., 2012
whole organism decreased mobility, abnormal WT + MO1-smyd2a text only from Donlin et al., 2012
Phenotype of all Fish created by or utilizing MO1-smyd2a
Phenotype Fish Conditions Figures
heart decreased thickness, abnormal WT + MO1-smyd2a standard conditions text only from Voelkel et al., 2013
skeletal muscle cell Z disc disorganized, abnormal WT + MO1-smyd2a standard conditions Fig. 5 from Donlin et al., 2012
heart decreased functionality, abnormal WT + MO1-smyd2a standard conditions Fig. 5 from Voelkel et al., 2013
sarcomere organization disrupted, abnormal WT + MO1-smyd2a standard conditions Fig. 5 from Donlin et al., 2012
cardiac ventricle malformed, abnormal WT + MO1-smyd2a standard conditions Fig. 5,  text only from Voelkel et al., 2013
heart development disrupted, abnormal WT + MO1-smyd2a standard conditions Fig. 5 from Donlin et al., 2012
post-vent region increased curvature, abnormal WT + MO1-smyd2a standard conditions Fig. 5 from Donlin et al., 2012
skeletal muscle tissue development disrupted, abnormal WT + MO1-smyd2a standard conditions Fig. 5 from Donlin et al., 2012
skeletal muscle cell I band disorganized, abnormal WT + MO1-smyd2a standard conditions Fig. 5 from Donlin et al., 2012
heart contraction decreased rate, abnormal WT + MO1-smyd2a standard conditions text only from Voelkel et al., 2013
text only from Donlin et al., 2012
skeletal muscle morphology, abnormal WT + MO1-smyd2a standard conditions text only from Voelkel et al., 2013
heart elongated, abnormal WT + MO1-smyd2a standard conditions text only from Voelkel et al., 2013
Fig. 5 from Donlin et al., 2012
atrium malformed, abnormal WT + MO1-smyd2a standard conditions Fig. 5,  text only from Voelkel et al., 2013
pericardium edematous, abnormal WT + MO1-smyd2a standard conditions text only from Voelkel et al., 2013
Fig. 5 from Donlin et al., 2012
whole organism decreased mobility, abnormal WT + MO1-smyd2a standard conditions text only from Donlin et al., 2012
skeletal muscle cell sarcomere disorganized, abnormal WT + MO1-smyd2a standard conditions Fig. 5 from Donlin et al., 2012
heart decreased contractility, abnormal WT + MO1-smyd2a standard conditions Fig. 5 from Voelkel et al., 2013
sinus venosus edematous, abnormal WT + MO1-smyd2a standard conditions text only from Voelkel et al., 2013
Fig. 5 from Donlin et al., 2012
skeletal muscle cell disorganized, abnormal WT + MO1-smyd2a standard conditions Fig. 5 from Donlin et al., 2012
heart decreased contractility, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions Fig. 5 from Voelkel et al., 2013
post-vent region increased curvature, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions Fig. 5 from Donlin et al., 2012
whole organism decreased mobility, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions text only from Donlin et al., 2012
heart contraction decreased rate, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions text only from Donlin et al., 2012
sinus venosus edematous, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions Fig. 5 from Donlin et al., 2012
cardiac ventricle malformed, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions Fig. 5 from Voelkel et al., 2013
atrium malformed, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions Fig. 5 from Voelkel et al., 2013
peptidyl-lysine methylation decreased occurrence, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions Fig. 5 from Donlin et al., 2012
pericardium edematous, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions Fig. 5 from Donlin et al., 2012
heart decreased functionality, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions Fig. 5 from Voelkel et al., 2013
skeletal muscle morphology, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions text only from Voelkel et al., 2013
heart elongated, abnormal WT + MO1-smyd2a + MO1-smyd2b standard conditions Fig. 5 from Donlin et al., 2012
Citations