Morpholino

MO1-tbl3

ID

ZDB-MRPHLNO-120813-4

Name

MO1-tbl3

Previous Names

None

Target

tbl3 (1)

Sequence

5' - TGAAGAGCAGCGTTTTCCCAGCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tbl3

Expressed Gene	Anatomy	Figures
fabp2	intestine	Fig. 3 from Hutchinson et al., 2012
lck	(not) T cell	Fig. 3 from Hutchinson et al., 2012
myb	hematopoietic stem cell	Fig. 3 from Hutchinson et al., 2012
prss1	exocrine pancreas	Fig. 3 from Hutchinson et al., 2012
vsx2	ciliary marginal zone retina central region	Fig. 5 from Hutchinson et al., 2012

Phenotype

Phenotype resulting from MO1-tbl3

Phenotype	Fish	Figures
blood island has fewer parts of type hematopoietic stem cell, abnormal	la2Tg + MO1-tbl3	Fig. 4 from Hutchinson et al., 2012
cell population proliferation increased occurrence, abnormal	WT + MO1-tbl3	Fig. 6 from Hutchinson et al., 2012
exocrine pancreas hypoplastic, abnormal	WT + MO1-tbl3	Fig. 3 from Hutchinson et al., 2012
hematopoietic stem cell decreased amount, abnormal	WT + MO1-tbl3	Fig. 3 from Hutchinson et al., 2012
hematopoietic stem cell proliferation decreased rate, abnormal	la2Tg + MO1-tbl3	Fig. 4 from Hutchinson et al., 2012
intestine hypoplastic, abnormal	WT + MO1-tbl3	Fig. 3 from Hutchinson et al., 2012
M phase increased duration, abnormal	WT + MO1-tbl3	Fig. 6 from Hutchinson et al., 2012
retina morphogenesis in camera-type eye delayed, abnormal	WT + MO1-tbl3	Fig. 6 from Hutchinson et al., 2012
S phase increased duration, abnormal	WT + MO1-tbl3	Fig. 6 from Hutchinson et al., 2012
T cell absent, abnormal	cz1Tg + MO1-tbl3	Fig. 3 from Hutchinson et al., 2012

Phenotype of all Fish created by or utilizing MO1-tbl3

Phenotype	Fish	Conditions	Figures
retina morphogenesis in camera-type eye delayed, abnormal	WT + MO1-tbl3	standard conditions	Fig. 6 from Hutchinson et al., 2012
exocrine pancreas hypoplastic, abnormal	WT + MO1-tbl3	standard conditions	Fig. 3 from Hutchinson et al., 2012
M phase increased duration, abnormal	WT + MO1-tbl3	standard conditions	Fig. 6 from Hutchinson et al., 2012
S phase increased duration, abnormal	WT + MO1-tbl3	standard conditions	Fig. 6 from Hutchinson et al., 2012
cell population proliferation increased occurrence, abnormal	WT + MO1-tbl3	standard conditions	Fig. 6 from Hutchinson et al., 2012
hematopoietic stem cell decreased amount, abnormal	WT + MO1-tbl3	standard conditions	Fig. 3 from Hutchinson et al., 2012
intestine hypoplastic, abnormal	WT + MO1-tbl3	standard conditions	Fig. 3 from Hutchinson et al., 2012
T cell absent, abnormal	cz1Tg + MO1-tbl3	standard conditions	Fig. 3 from Hutchinson et al., 2012
blood island has fewer parts of type hematopoietic stem cell, abnormal	la2Tg + MO1-tbl3	standard conditions	Fig. 4 from Hutchinson et al., 2012
hematopoietic stem cell proliferation decreased rate, abnormal	la2Tg + MO1-tbl3	standard conditions	Fig. 4 from Hutchinson et al., 2012
intestine hypoplastic, abnormal	tp53^zy7/zy7 + MO1-tbl3	standard conditions	Fig. 3 from Hutchinson et al., 2012
hematopoietic stem cell decreased amount, abnormal	tp53^zy7/zy7 + MO1-tbl3	standard conditions	Fig. 3 from Hutchinson et al., 2012
exocrine pancreas hypoplastic, abnormal	tp53^zy7/zy7 + MO1-tbl3	standard conditions	Fig. 3 from Hutchinson et al., 2012

Citations