Morpholino

MO3-nostrin

ID
ZDB-MRPHLNO-120809-4
Name
MO3-nostrin
Previous Names
None
Target
Sequence
5' - TCCAACACGTCTCCTGGCAGATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nostrin
Expressed Gene Anatomy Figures
nostrin Fig. 1 from Kovacevic et al., 2012
Phenotype
Phenotype resulting from MO3-nostrin
Phenotype Fish Figures
brain hemorrhagic, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
caudal artery malformed, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
caudal vein plexus malformed, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
dorsal longitudinal anastomotic vessel broken, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
dorsal longitudinal anastomotic vessel shape, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
heart hemorrhagic, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
hindbrain edematous, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
intersegmental vessel fused with intersegmental vessel, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
pericardium edematous, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
sprouting angiogenesis disrupted, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
vasculature development disrupted, abnormal y1Tg + MO3-nostrin Fig. 1 from Kovacevic et al., 2012
Phenotype of all Fish created by or utilizing MO3-nostrin
Phenotype Fish Conditions Figures
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
dorsal longitudinal anastomotic vessel shape, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
hindbrain edematous, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
pericardium edematous, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
vasculature development disrupted, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
dorsal longitudinal anastomotic vessel broken, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
sprouting angiogenesis disrupted, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
caudal vein plexus malformed, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
caudal artery malformed, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
intersegmental vessel fused with intersegmental vessel, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
heart hemorrhagic, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
brain hemorrhagic, abnormal y1Tg + MO3-nostrin standard conditions Fig. 1 from Kovacevic et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.