Morpholino

MO2-vcp

ID
ZDB-MRPHLNO-120717-2
Name
MO2-vcp
Previous Names
  • CDC48-MO2 (1)
Target
Sequence
5' - TAGTTGATGGAAATGAGTAGCTCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO, targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vcp
No data available
Phenotype
Phenotype resulting from MO2-vcp
Phenotype Fish Figures
brain apoptotic, abnormal WT + MO2-vcp Fig. S3 from Imamura et al., 2012
brain degeneration, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
cranial nerve II decreased width, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
diencephalon apoptotic, abnormal WT + MO2-vcp Fig. S3 from Imamura et al., 2012
diencephalon cell decreased amount, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
diencephalon nucleus aggregated, abnormal WT + MO2-vcp Fig. 3 from Imamura et al., 2012
embryo development delayed, abnormal WT + MO2-vcp Fig. 1 from Imamura et al., 2012
eye apoptotic, abnormal WT + MO2-vcp Fig. S3 from Imamura et al., 2012
eye degeneration, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
eye size, abnormal WT + MO2-vcp Fig. 1,  Fig. 4 from Imamura et al., 2012
eye nucleus aggregated, abnormal WT + MO2-vcp Fig. 3 from Imamura et al., 2012
head size, abnormal WT + MO2-vcp Fig. 1,  Fig. 4 from Imamura et al., 2012
motor neuron axon branched, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
motor neuron axon truncated, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
retinal ganglion cell layer decayed, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
retinal ganglion cell layer neuron degenerate, abnormal WT + MO2-vcp Fig. 3 from Imamura et al., 2012
retinal inner plexiform layer decayed, abnormal WT + MO2-vcp Fig. 2 from Imamura et al., 2012
retinal inner plexiform layer neuron degenerate, abnormal WT + MO2-vcp Fig. 3 from Imamura et al., 2012
trunk curved ventral, abnormal WT + MO2-vcp Fig. 1,  Fig. 4,  Fig. S2 from Imamura et al., 2012
Phenotype of all Fish created by or utilizing MO2-vcp
Phenotype Fish Conditions Figures
eye size, abnormal WT + MO2-vcp standard conditions Fig. 1,  Fig. 4 from Imamura et al., 2012
eye degeneration, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
cranial nerve II decreased width, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
diencephalon cell decreased amount, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
motor neuron axon branched, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
eye nucleus aggregated, abnormal WT + MO2-vcp standard conditions Fig. 3 from Imamura et al., 2012
retinal ganglion cell layer neuron degenerate, abnormal WT + MO2-vcp standard conditions Fig. 3 from Imamura et al., 2012
trunk curved ventral, abnormal WT + MO2-vcp standard conditions Fig. 1,  Fig. 4,  Fig. S2 from Imamura et al., 2012
brain apoptotic, abnormal WT + MO2-vcp standard conditions Fig. S3 from Imamura et al., 2012
eye apoptotic, abnormal WT + MO2-vcp standard conditions Fig. S3 from Imamura et al., 2012
embryo development delayed, abnormal WT + MO2-vcp standard conditions Fig. 1 from Imamura et al., 2012
retinal ganglion cell layer decayed, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
motor neuron axon truncated, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
diencephalon apoptotic, abnormal WT + MO2-vcp standard conditions Fig. S3 from Imamura et al., 2012
retinal inner plexiform layer neuron degenerate, abnormal WT + MO2-vcp standard conditions Fig. 3 from Imamura et al., 2012
head size, abnormal WT + MO2-vcp standard conditions Fig. 1,  Fig. 4 from Imamura et al., 2012
retinal inner plexiform layer decayed, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
brain degeneration, abnormal WT + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
diencephalon nucleus aggregated, abnormal WT + MO2-vcp standard conditions Fig. 3 from Imamura et al., 2012
motor neuron axon branched, abnormal rw0Tg + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
motor neuron axon truncated, abnormal rw0Tg + MO2-vcp standard conditions Fig. 2 from Imamura et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.