header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-120710-1
Morpholino Name: MO1-leo1
Target: leo1 (1)
Sequence:
5' - TATGAATGTACCTCGTTGCTCATTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-leo1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-leo1
Expressed Gene Anatomy Figures
cdkn1bb Fig. 4 from Kim et al., 2012
cdkn1ca Fig. 4 from Kim et al., 2012
id2b Fig. 4 from Kim et al., 2012
id4 Fig. 4 from Kim et al., 2012
qki2 Fig. 4 from Kim et al., 2012
sox5 Fig. 4 from Kim et al., 2012
sox6 Fig. 4 from Kim et al., 2012
sox10 Fig. 4 from Kim et al., 2012
tcf4 Fig. 4 from Kim et al., 2012
PHENOTYPE
Phenotype resulting from MO1-leo1
Phenotype of all Fish created by or utilizing MO1-leo1
Genome Resources:
CITATIONS (1)