Morpholino

MO1-msi1b

ID
ZDB-MRPHLNO-120614-1
Name
MO1-msi1b
Previous Names
  • MO1-msi1
  • zmsi1-1 MO (1)
Target
Sequence
5' - TACTTTGGCTGCCTTCCGATTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-msi1b
Expressed Gene Anatomy Figures
msi1b Fig. 7 from Shibata et al., 2012
Phenotype
Phenotype resulting from MO1-msi1b
Phenotype Fish Figures
brain hypoplastic, abnormal knu3Tg + MO1-msi1b Fig. 7 from Shibata et al., 2012
eye decreased size, abnormal RW + MO1-msi1b Fig. 7 from Shibata et al., 2012
eye immature, abnormal RW + MO1-msi1b Fig. 7 from Shibata et al., 2012
head decreased size, abnormal RW + MO1-msi1b Fig. 7 from Shibata et al., 2012
locomotion involved in locomotory behavior disrupted, abnormal RW + MO1-msi1b Fig. 7 from Shibata et al., 2012
pericardium edematous, abnormal RW + MO1-msi1b Fig. 7 from Shibata et al., 2012
post-vent region decreased length, abnormal RW + MO1-msi1b Fig. 7 from Shibata et al., 2012
spinal cord hypoplastic, abnormal knu3Tg + MO1-msi1b Fig. 7 from Shibata et al., 2012
whole organism decreased length, abnormal RW + MO1-msi1b Fig. 7 from Shibata et al., 2012
whole organism increased curvature, abnormal RW + MO1-msi1b Fig. 7 from Shibata et al., 2012
whole organism viability, abnormal RW + MO1-msi1b Fig. 7 from Shibata et al., 2012
Phenotype of all Fish created by or utilizing MO1-msi1b
Phenotype Fish Conditions Figures
locomotion involved in locomotory behavior disrupted, abnormal RW + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
pericardium edematous, abnormal RW + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
eye immature, abnormal RW + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
whole organism increased curvature, abnormal RW + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
whole organism viability, abnormal RW + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
whole organism decreased length, abnormal RW + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
head decreased size, abnormal RW + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
post-vent region decreased length, abnormal RW + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
eye decreased size, abnormal RW + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
brain hypoplastic, abnormal knu3Tg + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
spinal cord hypoplastic, abnormal knu3Tg + MO1-msi1b standard conditions Fig. 7 from Shibata et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.