Morpholino

MO1-rnf2

ID
ZDB-MRPHLNO-120606-5
Name
MO1-rnf2
Previous Names
  • ATGMO1 (1)
Target
Sequence
5' - ACACCACGTCTTTTATCTCAATGTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rnf2
Expressed Gene Anatomy Figures
fgf24 Fig. S4 with image from van der Velden et al., 2012
hand2 Fig. S4 with image from van der Velden et al., 2012
tbx5a Fig. S4 with image from van der Velden et al., 2012
tp53 Fig. 7 from Lee et al., 2013
Phenotype
Phenotype resulting from MO1-rnf2
Phenotype Fish Figures
pectoral fin absent, abnormal WT + MO1-rnf2 Fig. S4 with image from van der Velden et al., 2012
pectoral fin morphogenesis disrupted, abnormal WT + MO1-rnf2 Fig. S4 with image from van der Velden et al., 2012
pericardium edematous, abnormal WT + MO1-rnf2 Fig. S4 with image from van der Velden et al., 2012
retina perforate, abnormal WT + MO1-rnf2 Fig. 7 from Lee et al., 2013
retina cell apoptotic, abnormal WT + MO1-rnf2 Fig. 7 from Lee et al., 2013
retina intrinsic apoptotic signaling pathway by p53 class mediator increased occurrence, abnormal WT + MO1-rnf2 Fig. 7 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-rnf2 Fig. 7 from Lee et al., 2013
Phenotype of all Fish created by or utilizing MO1-rnf2
Phenotype Fish Conditions Figures
retina cell apoptotic, abnormal WT + MO1-rnf2 standard conditions Fig. 7 from Lee et al., 2013
pectoral fin morphogenesis disrupted, abnormal WT + MO1-rnf2 standard conditions Fig. S4 with image from van der Velden et al., 2012
pericardium edematous, abnormal WT + MO1-rnf2 standard conditions Fig. S4 with image from van der Velden et al., 2012
retina intrinsic apoptotic signaling pathway by p53 class mediator increased occurrence, abnormal WT + MO1-rnf2 standard conditions Fig. 7 from Lee et al., 2013
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-rnf2 standard conditions Fig. 7 from Lee et al., 2013
retina perforate, abnormal WT + MO1-rnf2 standard conditions Fig. 7 from Lee et al., 2013
pectoral fin absent, abnormal WT + MO1-rnf2 standard conditions Fig. S4 with image from van der Velden et al., 2012
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-bcor + MO1-rnf2 standard conditions Fig. 7 from Lee et al., 2013
retina perforate, abnormal WT + MO1-bcor + MO1-rnf2 standard conditions Fig. 7 from Lee et al., 2013
heart edematous, abnormal WT + MO1-bcor + MO1-rnf2 standard conditions Fig. 7 from Lee et al., 2013
optic fissure open, abnormal WT + MO1-bcor + MO1-rnf2 standard conditions Fig. 7 from Lee et al., 2013
pectoral fin absent, abnormal WT + MO1-bcor + MO1-rnf2 standard conditions Fig. 7 from Lee et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.