Morpholino

MO1-ppp4cb

ID
ZDB-MRPHLNO-120606-3
Name
MO1-ppp4cb
Previous Names
None
Target
Sequence
5' - AGCCCGTCTGCCTGTTTTCCCCTCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO, targets the 5' UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ppp4cb
Expressed Gene Anatomy Figures
chrd Fig. 1 with image from Jia et al., 2012
eve1 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Jia et al., 2012
foxi1 Fig. 3 with image from Jia et al., 2012
gata2a Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image from Jia et al., 2012
gsc Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Jia et al., 2012
Phenotype
Phenotype resulting from MO1-ppp4cb
Phenotype Fish Figures
caudal fin curved, abnormal WT + MO1-ppp4cb + MO5-tp53 Fig. 1 with image from Jia et al., 2012
caudal fin decreased thickness, abnormal WT + MO1-ppp4cb + MO5-tp53 Fig. 1 with image from Jia et al., 2012
trunk posterior region decreased size, abnormal WT + MO1-ppp4cb + MO5-tp53 Fig. 1 with image from Jia et al., 2012
whole organism elongated, abnormal WT + MO1-ppp4cb Fig. 2 with image,  Fig. 3 with image from Jia et al., 2012
whole organism necrotic, abnormal WT + MO1-ppp4cb Fig. 1 with image from Jia et al., 2012
whole organism wholly dorsalized, abnormal WT + MO1-ppp4cb Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Jia et al., 2012
Phenotype of all Fish created by or utilizing MO1-ppp4cb
Phenotype Fish Conditions Figures
whole organism elongated, abnormal WT + MO1-ppp4cb standard conditions Fig. 2 with image,  Fig. 3 with image from Jia et al., 2012
whole organism wholly dorsalized, abnormal WT + MO1-ppp4cb standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 7 with image from Jia et al., 2012
whole organism necrotic, abnormal WT + MO1-ppp4cb standard conditions Fig. 1 with image from Jia et al., 2012
caudal fin curved, abnormal WT + MO1-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
caudal fin decreased thickness, abnormal WT + MO1-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
trunk posterior region decreased size, abnormal WT + MO1-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
whole organism wholly dorsalized, abnormal WT + MO1-ppp4cb + MO5-tp53 standard conditions Fig. 1 with image from Jia et al., 2012
whole organism wholly dorsalized, abnormal WT + MO1-hdac1 + MO1-ppp4cb standard conditions Fig. 7 with image from Jia et al., 2012
whole organism wholly dorsalized, abnormal WT + MO1-hdac3 + MO1-ppp4cb standard conditions Fig. 7 with image from Jia et al., 2012
whole organism wholly dorsalized, abnormal WT + MO1-ppp4cb + MO3-ppp4ca standard conditions Fig. 1 with image from Jia et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.