Morpholino
MO1-med25
- ID
- ZDB-MRPHLNO-120518-4
- Name
- MO1-med25
- Previous Names
- None
- Target
- Sequence
-
5' - TATGGGTCACCTTTGGTCTACAGCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-med25
No data available
Phenotype
Phenotype resulting from MO1-med25
Phenotype | Fish | Figures |
---|---|---|
palate malformed, abnormal | AB + MO1-med25 |
Fig. 4
from Nakamura et al., 2011 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-med25
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
palate malformed, abnormal | AB + MO1-med25 | standard conditions |
Fig. 4
from Nakamura et al., 2011 |
1 - 1 of 1
Citations
- Gonzaga-Jauregui, C., Harel, T., Gambin, T., Kousi, M., Griffin, L.B., Francescatto, L., Ozes, B., Karaca, E., Jhangiani, S.N., Bainbridge, M.N., Lawson, K.S., Pehlivan, D., Okamoto, Y., Withers, M., Mancias, P., Slavotinek, A., Reitnauer, P.J., Goksungur, M.T., Shy, M., Crawford, T.O., Koenig, M., Willer, J., Flores, B.N., Pediaditrakis, I., Us, O., Wiszniewski, W., Parman, Y., Antonellis, A., Muzny, D.M., Baylor-Hopkins Center for Mendelian Genomics, Katsanis, N., Battaloglu, E., Boerwinkle, E., Gibbs, R.A., Lupski, J.R. (2015) Exome Sequence Analysis Suggests that Genetic Burden Contributes to Phenotypic Variability and Complex Neuropathy. Cell Reports. 12(7):1169-83
- Nakamura, Y., Yamamoto, K., He, X., Otsuki, B., Kim, Y., Murao, H., Soeda, T., Tsumaki, N., Deng, J.M., Zhang, Z., Behringer, R.R., Crombrugghe, B., Postlethwait, J.H., Warman, M.L., Nakamura, T., and Akiyama, H. (2011) Wwp2 is essential for palatogenesis mediated by the interaction between Sox9 and mediator subunit 25. Nature communications. 2:251
1 - 2 of 2
Show