Morpholino

MO3-appb

ID
ZDB-MRPHLNO-120514-1
Name
MO3-appb
Previous Names
None
Target
Sequence
5' - GCACCTGCCAACAGCACAACCGGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-appb
No data available
Phenotype
Phenotype resulting from MO3-appb
Phenotype Fish Figures
axonogenesis disrupted, abnormal WT + MO3-appb Fig. S2 with image from Song et al., 2012
facial nerve motor nucleus axon decreased length, abnormal rw0Tg + MO3-appb Fig. 2 with image from Song et al., 2012
Mauthner neuron microtubule decreased amount, abnormal WT + MO3-appb Fig. 4 with image from Song et al., 2012
Mauthner neuron microtubule cytoskeleton decreased mass density, abnormal WT + MO3-appb Fig. 4 with image from Song et al., 2012
midbrain development disrupted, abnormal WT + MO3-appb Fig. 1 with image from Song et al., 2012
motor neuron axon decreased branchiness, abnormal rw0Tg + MO3-appb Fig. 2 with image from Song et al., 2012
motor neuron cytoskeleton disorganized, abnormal WT + MO3-appb Fig. 4 with image from Song et al., 2012
neuron projection development disrupted, abnormal rw0Tg + MO3-appb Fig. 2 with image from Song et al., 2012
post-vent region curved, abnormal WT + MO3-appb Fig. 1 with image from Song et al., 2012
post-vent region decreased length, abnormal WT + MO3-appb Fig. 1 with image from Song et al., 2012
trigeminal motor nucleus axon decreased length, abnormal rw0Tg + MO3-appb Fig. 2 with image from Song et al., 2012
trunk deformed, abnormal WT + MO3-appb Fig. 1 with image from Song et al., 2012
Phenotype of all Fish created by or utilizing MO3-appb
Phenotype Fish Conditions Figures
motor neuron cytoskeleton disorganized, abnormal WT + MO3-appb standard conditions Fig. 4 with image from Song et al., 2012
Mauthner neuron microtubule cytoskeleton decreased mass density, abnormal WT + MO3-appb standard conditions Fig. 4 with image from Song et al., 2012
trunk deformed, abnormal WT + MO3-appb standard conditions Fig. 1 with image from Song et al., 2012
post-vent region curved, abnormal WT + MO3-appb standard conditions Fig. 1 with image from Song et al., 2012
Mauthner neuron microtubule decreased amount, abnormal WT + MO3-appb standard conditions Fig. 4 with image from Song et al., 2012
axonogenesis disrupted, abnormal WT + MO3-appb standard conditions Fig. S2 with image from Song et al., 2012
post-vent region decreased length, abnormal WT + MO3-appb standard conditions Fig. 1 with image from Song et al., 2012
midbrain development disrupted, abnormal WT + MO3-appb standard conditions Fig. 1 with image from Song et al., 2012
neuron projection development disrupted, abnormal rw0Tg + MO3-appb standard conditions Fig. 2 with image from Song et al., 2012
trigeminal motor nucleus axon decreased length, abnormal rw0Tg + MO3-appb standard conditions Fig. 2 with image from Song et al., 2012
facial nerve motor nucleus axon decreased length, abnormal rw0Tg + MO3-appb standard conditions Fig. 2 with image from Song et al., 2012
motor neuron axon decreased branchiness, abnormal rw0Tg + MO3-appb standard conditions Fig. 2 with image from Song et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.