Morpholino
MO1-sdc3
- ID
- ZDB-MRPHLNO-120427-1
- Name
- MO1-sdc3
- Previous Names
-
- MOsdc3 (1)
- Target
- Sequence
-
5' - CTCCTCTTTCGGGTGCTGGGTGTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sdc3
No data available
Phenotype
Phenotype resulting from MO1-sdc3
| Phenotype | Fish | Figures |
|---|---|---|
| epiboly involved in gastrulation with mouth forming second disrupted, abnormal | AB + MO1-sdc3 |
Fig. 5
from Lambaerts et al., 2012 |
Phenotype of all Fish created by or utilizing MO1-sdc3
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| epiboly involved in gastrulation with mouth forming second disrupted, abnormal | AB + MO1-sdc3 | standard conditions |
Fig. 5
from Lambaerts et al., 2012 |
Citations