Morpholino

MO5-dysf

ID
ZDB-MRPHLNO-120404-2
Name
MO5-dysf
Previous Names
  • i36/e37 MO (1)
Target
Sequence
5' - GGCAATCGCTGAAGAGAGTGCAGAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-dysf
No data available
Phenotype
Phenotype resulting from MO5-dysf
Phenotype Fish Figures
heart edematous, abnormal AB + MO5-dysf Fig. 1 with image from Roostalu et al., 2012
heart contraction decreased rate, abnormal AB + MO5-dysf Fig. S1 with image from Roostalu et al., 2012
muscle damaged, abnormal AB + MO5-dysf Fig. 1 with image from Roostalu et al., 2012
muscle myofibril misrouted, abnormal AB + MO5-dysf Fig. 1 with image from Roostalu et al., 2012
muscle T-tubule broken, abnormal AB + MO5-dysf Fig. 1 with image from Roostalu et al., 2012
muscle T-tubule misaligned with muscle T-tubule, abnormal AB + MO5-dysf Fig. 1 with image from Roostalu et al., 2012
muscle cell development disrupted, abnormal AB + MO5-dysf Fig. 1 with image from Roostalu et al., 2012
trunk curved, abnormal AB + MO5-dysf Fig. 1 with image from Roostalu et al., 2012
Phenotype of all Fish created by or utilizing MO5-dysf
Phenotype Fish Conditions Figures
heart edematous, abnormal AB + MO5-dysf standard conditions Fig. 1 with image from Roostalu et al., 2012
muscle T-tubule broken, abnormal AB + MO5-dysf standard conditions Fig. 1 with image from Roostalu et al., 2012
muscle T-tubule misaligned with muscle T-tubule, abnormal AB + MO5-dysf standard conditions Fig. 1 with image from Roostalu et al., 2012
muscle damaged, abnormal AB + MO5-dysf standard conditions Fig. 1 with image from Roostalu et al., 2012
muscle cell development disrupted, abnormal AB + MO5-dysf standard conditions Fig. 1 with image from Roostalu et al., 2012
trunk curved, abnormal AB + MO5-dysf standard conditions Fig. 1 with image from Roostalu et al., 2012
heart contraction decreased rate, abnormal AB + MO5-dysf standard conditions Fig. S1 with image from Roostalu et al., 2012
muscle myofibril misrouted, abnormal AB + MO5-dysf standard conditions Fig. 1 with image from Roostalu et al., 2012
muscle cell cytoplasmic vesicle accumulation muscle sarcolemma, abnormal AB + MO1-anxa6 + MO5-dysf standard conditions Fig. 6 with image from Roostalu et al., 2012
muscle T-tubule broken, abnormal AB + MO1-anxa6 + MO5-dysf standard conditions Fig. 6 with image from Roostalu et al., 2012
heart edematous, abnormal AB + MO1-anxa6 + MO5-dysf standard conditions Fig. 6 with image from Roostalu et al., 2012
muscle damaged, abnormal AB + MO1-anxa6 + MO5-dysf standard conditions Fig. 6 with image from Roostalu et al., 2012
muscle myofibril misaligned with muscle myofibril, abnormal AB + MO1-anxa6 + MO5-dysf standard conditions Fig. 6 with image from Roostalu et al., 2012
trunk curved, abnormal AB + MO1-anxa6 + MO5-dysf standard conditions Fig. 6 with image from Roostalu et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.