Morpholino

MO2-b9d2

ID

ZDB-MRPHLNO-120402-3

Name

MO2-b9d2

Previous Names

None

Target

b9d2 (1)

Sequence

5' - CACTATAAGCTCGCGTACCACAACG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-b9d2

No data available

Phenotype

Phenotype resulting from MO2-b9d2

Phenotype	Fish	Figures
opsin transport disrupted, abnormal	WT + MO2-b9d2	Fig. 4 from Zhao et al., 2011
photoreceptor cell morphology, abnormal	WT + MO2-b9d2	Fig. 2 from Zhao et al., 2011
protein localization to cilium disrupted, abnormal	WT + MO2-b9d2	Fig. 5 from Zhao et al., 2011

Phenotype of all Fish created by or utilizing MO2-b9d2

Phenotype	Fish	Conditions	Figures
opsin transport disrupted, abnormal	WT + MO2-b9d2	standard conditions	Fig. 4 from Zhao et al., 2011
photoreceptor cell morphology, abnormal	WT + MO2-b9d2	standard conditions	Fig. 2 from Zhao et al., 2011
protein localization to cilium disrupted, abnormal	WT + MO2-b9d2	standard conditions	Fig. 5 from Zhao et al., 2011
olfactory pit cilium decreased length, abnormal	ift70^m477/+ + MO2-b9d2	standard conditions	Fig. S4 from Zhao et al., 2011
spinal cord cilium decreased length, abnormal	WT + MO1-ift70 + MO2-b9d2	standard conditions	Fig. 2 from Zhao et al., 2011
opsin transport disrupted, abnormal	WT + MO1-ift70 + MO2-b9d2	standard conditions	Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal	WT + MO1-ift70 + MO2-b9d2	standard conditions	Fig. 6, Fig. S4 from Zhao et al., 2011
olfactory pit cilium decreased length, abnormal	WT + MO1-ift70 + MO2-b9d2	standard conditions	Fig. 2, Fig. S4 from Zhao et al., 2011
protein localization to cilium disrupted, abnormal	WT + MO1-ift70 + MO2-b9d2	standard conditions	Fig. 5 from Zhao et al., 2011
determination of left/right symmetry disrupted, abnormal	WT + MO1-ift70 + MO2-b9d2	standard conditions	Fig. 6 from Zhao et al., 2011
establishment of planar polarity disrupted, abnormal	WT + MO1-vangl2 + MO2-b9d2	standard conditions	Fig. 7 from Zhao et al., 2011
neuromast hair cell disoriented, abnormal	WT + MO1-vangl2 + MO2-b9d2	standard conditions	Fig. 7 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal	WT + MO2-b9d2 + MO2-ift52	standard conditions	Fig. 6 from Zhao et al., 2011
determination of left/right symmetry disrupted, abnormal	WT + MO2-b9d2 + MO2-invs	standard conditions	Fig. 6 from Zhao et al., 2011
whole organism anterior-posterior axis curved, abnormal	WT + MO2-b9d2 + MO2-invs	standard conditions	Fig. 6 from Zhao et al., 2011
opsin transport disrupted, abnormal	WT + MO2-b9d2 + MO2-invs	standard conditions	Fig. 6 from Zhao et al., 2011
head hydrocephalic, abnormal	WT + MO1-b9d1 + MO2-b9d2 + MO2-mks1	standard conditions	Fig. S5 from Zhao et al., 2011

Citations