Morpholino

MO1-tpbg1b

ID
ZDB-MRPHLNO-120207-7
Name
MO1-tpbg1b
Previous Names
  • MO1-tpbga
  • MO1-tpbgl (1)
  • waif1a MO1 (1)
Target
Sequence
5' - GAGATCCAAAGTGTCTCTCCAAGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO. Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tpbg1b
No data available
Phenotype
Phenotype resulting from MO1-tpbg1b
Phenotype of all Fish created by or utilizing MO1-tpbg1b
Phenotype Fish Conditions Figures
anterior neural plate otx2b expression decreased distribution, abnormal WT + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
anatomical structure sp5l expression increased amount, abnormal WT + MO1-tpbg1b standard conditions Fig. 2 with image from Kagermeier-Schenk et al., 2011
presumptive telencephalon foxg1a expression decreased distribution, abnormal WT + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
posterior neural plate hoxb1b expression increased distribution, abnormal WT + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
whole organism dorsal region gsc expression decreased distribution, abnormal WT + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
anatomical structure cdx4 expression increased amount, abnormal WT + MO1-tpbg1b standard conditions Fig. 2 with image from Kagermeier-Schenk et al., 2011
anatomical structure vent expression increased amount, abnormal WT + MO1-tpbg1b standard conditions Fig. 2 with image from Kagermeier-Schenk et al., 2011
notochord aplastic/hypoplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
whole organism wholly dorsalized, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye absent, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain hindbrain boundary aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head anterior region truncated, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
forebrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
somite increased width, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
convergent extension involved in axis elongation process quality, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
midbrain hindbrain boundary increased width, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
somite condensed, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
rhombomere increased width, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
convergent extension disrupted, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
Citations