Morpholino

MO1-tpbg1b

ID
ZDB-MRPHLNO-120207-7
Name
MO1-tpbg1b
Previous Names
  • MO1-tpbga
  • MO1-tpbgl (1)
  • waif1a MO1 (1)
Target
Sequence
5' - GAGATCCAAAGTGTCTCTCCAAGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO. Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tpbg1b
Expressed Gene Anatomy Figures
cdx4 Fig. 2 with image from Kagermeier-Schenk et al., 2011
egr2b Fig. 8 with image from Kagermeier-Schenk et al., 2011
foxg1a Fig. 3 with image from Kagermeier-Schenk et al., 2011
gsc Fig. 3 with image from Kagermeier-Schenk et al., 2011
hoxb1b Fig. 3 with image from Kagermeier-Schenk et al., 2011
myod1 Fig. 8 with image from Kagermeier-Schenk et al., 2011
otx2b Fig. 3 with image from Kagermeier-Schenk et al., 2011
pax2a Fig. 8 with image from Kagermeier-Schenk et al., 2011
sp5l Fig. 2 with image from Kagermeier-Schenk et al., 2011
vent Fig. 2 with image from Kagermeier-Schenk et al., 2011
Phenotype
Phenotype resulting from MO1-tpbg1b
Phenotype Fish Figures
anatomical structure cdx4 expression increased amount, abnormal WT + MO1-tpbg1b Fig. 2 with image from Kagermeier-Schenk et al., 2011
anatomical structure sp5l expression increased amount, abnormal WT + MO1-tpbg1b Fig. 2 with image from Kagermeier-Schenk et al., 2011
anatomical structure vent expression increased amount, abnormal WT + MO1-tpbg1b Fig. 2 with image from Kagermeier-Schenk et al., 2011
anterior neural plate otx2b expression decreased distribution, abnormal WT + MO1-tpbg1b Fig. 3 with image from Kagermeier-Schenk et al., 2011
posterior neural plate hoxb1b expression increased distribution, abnormal WT + MO1-tpbg1b Fig. 3 with image from Kagermeier-Schenk et al., 2011
presumptive telencephalon foxg1a expression decreased distribution, abnormal WT + MO1-tpbg1b Fig. 3 with image from Kagermeier-Schenk et al., 2011
whole organism dorsal region gsc expression decreased distribution, abnormal WT + MO1-tpbg1b Fig. 3 with image from Kagermeier-Schenk et al., 2011
Phenotype of all Fish created by or utilizing MO1-tpbg1b
Phenotype Fish Conditions Figures
anterior neural plate otx2b expression decreased distribution, abnormal WT + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
anatomical structure sp5l expression increased amount, abnormal WT + MO1-tpbg1b standard conditions Fig. 2 with image from Kagermeier-Schenk et al., 2011
presumptive telencephalon foxg1a expression decreased distribution, abnormal WT + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
posterior neural plate hoxb1b expression increased distribution, abnormal WT + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
whole organism dorsal region gsc expression decreased distribution, abnormal WT + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
anatomical structure cdx4 expression increased amount, abnormal WT + MO1-tpbg1b standard conditions Fig. 2 with image from Kagermeier-Schenk et al., 2011
anatomical structure vent expression increased amount, abnormal WT + MO1-tpbg1b standard conditions Fig. 2 with image from Kagermeier-Schenk et al., 2011
notochord aplastic/hypoplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
whole organism wholly dorsalized, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye absent, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain hindbrain boundary aplastic, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
eye decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
head anterior region truncated, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
midbrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
forebrain decreased size, abnormal WT + MO1-tcf7l1a + MO1-tpbg1b standard conditions Fig. 3 with image from Kagermeier-Schenk et al., 2011
somite increased width, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
convergent extension involved in axis elongation process quality, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
midbrain hindbrain boundary increased width, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
somite condensed, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
rhombomere increased width, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
convergent extension disrupted, abnormal WT + MO1-tpbg1b + MO2-dkk1b standard conditions Fig. 8 with image from Kagermeier-Schenk et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.