Morpholino

MO1-lhx9

ID
ZDB-MRPHLNO-120202-5
Name
MO1-lhx9
Previous Names
None
Target
Sequence
5' - GCCAAAACACAAATTCTTACCGTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lhx9
No data available
Phenotype
Phenotype resulting from MO1-lhx9
No data available
Phenotype of all Fish created by or utilizing MO1-lhx9
Phenotype Fish Conditions Figures
thalamus development decreased process quality, abnormal lhx2btv42z/tv42z + MO1-lhx9 standard conditions Fig. 5 with image from Peukert et al., 2011
dorsal thalamus cellular quality, abnormal lhx2btv42z/tv42z + MO1-lhx9 standard conditions Fig. 5 with image from Peukert et al., 2011
dorsal thalamus cell mislocalised, abnormal WT + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 6 with image from Peukert et al., 2011
dorsal thalamus CNS neuron (sensu Vertebrata) poorly differentiated, abnormal WT + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 2 with image from Peukert et al., 2011
epithalamus development process quality, abnormal WT + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 4 with image from Peukert et al., 2011
epithalamus increased size, abnormal WT + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 4 with image from Peukert et al., 2011
thalamus development decreased process quality, abnormal WT + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 2 with imageFig. 6 with image from Peukert et al., 2011
forebrain neuron differentiation decreased process quality, abnormal WT + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 2 with imageFig. 6 with image from Peukert et al., 2011
pretectum cell mislocalised, abnormal WT + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 6 with image from Peukert et al., 2011
dorsal thalamus fused with pretectum, abnormal WT + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 6 with image from Peukert et al., 2011
dorsal thalamus GABAergic neuron mislocalised posteriorly, abnormal WT + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 6 with image from Peukert et al., 2011
dorsal thalamus cellular quality, abnormal lhx2btv42z/tv42z + MO1-lhx9 + MO2-wnt3a standard conditions Fig. 5 with image from Peukert et al., 2011
thalamus development decreased process quality, abnormal lhx2btv42z/tv42z + MO1-lhx9 + MO2-wnt3a standard conditions Fig. 5 with image from Peukert et al., 2011
dorsal thalamus cell mislocalised, abnormal sud1Tg + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 6 with image from Peukert et al., 2011
thalamus development decreased process quality, abnormal sud1Tg + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 6 with image from Peukert et al., 2011
forebrain neuron differentiation decreased process quality, abnormal sb3Tg; zf255Tg + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 6 with image from Peukert et al., 2011
thalamus development decreased process quality, abnormal sb3Tg; zf255Tg + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 6 with image from Peukert et al., 2011
dorsal thalamus GABAergic neuron mislocalised posteriorly, abnormal sb3Tg; zf255Tg + MO1-lhx9 + MO3-lhx2b standard conditions Fig. 6 with image from Peukert et al., 2011
Citations