Morpholino

MO1-lhx9

ID

ZDB-MRPHLNO-120202-5

Name

MO1-lhx9

Previous Names

None

Target

lhx9 (1)

Sequence

5' - GCCAAAACACAAATTCTTACCGTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-lhx9

Expressed Gene	Anatomy	Figures
pcdh10b	dorsal thalamus postero-lateral region	Fig. 5 from Peukert et al., 2011

Phenotype

Phenotype resulting from MO1-lhx9

No data available

Phenotype of all Fish created by or utilizing MO1-lhx9

Phenotype	Fish	Conditions	Figures
thalamus development decreased process quality, abnormal	lhx2b^tv42z/tv42z + MO1-lhx9	standard conditions	Fig. 5 from Peukert et al., 2011
dorsal thalamus cellular quality, abnormal	lhx2b^tv42z/tv42z + MO1-lhx9	standard conditions	Fig. 5 from Peukert et al., 2011
dorsal thalamus cell mislocalised, abnormal	WT + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 6 from Peukert et al., 2011
dorsal thalamus CNS neuron (sensu Vertebrata) poorly differentiated, abnormal	WT + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 2 from Peukert et al., 2011
epithalamus development process quality, abnormal	WT + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 4 from Peukert et al., 2011
epithalamus increased size, abnormal	WT + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 4 from Peukert et al., 2011
thalamus development decreased process quality, abnormal	WT + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 2 , Fig. 6 from Peukert et al., 2011
forebrain neuron differentiation decreased process quality, abnormal	WT + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 2 , Fig. 6 from Peukert et al., 2011
pretectum cell mislocalised, abnormal	WT + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 6 from Peukert et al., 2011
dorsal thalamus fused with pretectum, abnormal	WT + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 6 from Peukert et al., 2011
dorsal thalamus GABAergic neuron mislocalised posteriorly, abnormal	WT + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 6 from Peukert et al., 2011
dorsal thalamus cellular quality, abnormal	lhx2b^tv42z/tv42z + MO1-lhx9 + MO2-wnt3a	standard conditions	Fig. 5 from Peukert et al., 2011
thalamus development decreased process quality, abnormal	lhx2b^tv42z/tv42z + MO1-lhx9 + MO2-wnt3a	standard conditions	Fig. 5 from Peukert et al., 2011
dorsal thalamus cell mislocalised, abnormal	sud1Tg + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 6 from Peukert et al., 2011
thalamus development decreased process quality, abnormal	sud1Tg + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 6 from Peukert et al., 2011
forebrain neuron differentiation decreased process quality, abnormal	sb3Tg; zf255Tg + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 6 from Peukert et al., 2011
thalamus development decreased process quality, abnormal	sb3Tg; zf255Tg + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 6 from Peukert et al., 2011
dorsal thalamus GABAergic neuron mislocalised posteriorly, abnormal	sb3Tg; zf255Tg + MO1-lhx9 + MO3-lhx2b	standard conditions	Fig. 6 from Peukert et al., 2011

Citations