Morpholino
MO1-jam2a
- ID
- ZDB-MRPHLNO-120130-1
- Name
- MO1-jam2a
- Previous Names
- None
- Target
- Sequence
-
5' - GCACACCAGCATTTTCTCCACAGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-jam2a
Expressed Gene | Anatomy | Figures |
---|---|---|
desma |
Fig. 3
from Kobayashi et al., 2014 |
|
efnb2a |
Fig. 3
from Kobayashi et al., 2014 |
|
fli1 |
Fig. 3
from Kobayashi et al., 2014 |
|
runx1 |
Fig. 3,
Fig. S7
from Kobayashi et al., 2014 |
1 - 4 of 4
Phenotype
Phenotype resulting from MO1-jam2a
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-jam2a
1 - 5 of 5
Citations
- Li, H., Edie, S., Klinedinst, D., Jeong, J.S., Blackshaw, S., Maslen, C.L., Reeves, R.H. (2016) Penetrance of Congenital Heart Disease in a Mouse Model of Down Syndrome Depends on a Trisomic Potentiator of a Disomic Modifier. Genetics. 203:763-70
- Kobayashi, I., Kobayashi-Sun, J., Kim, A.D., Pouget, C., Fujita, N., Suda, T., Traver, D. (2014) Jam1a-Jam2a interactions regulate haematopoietic stem cell fate through Notch signalling. Nature. 512(7514):319-23
- Powell, G.T., and Wright, G.J. (2011) Jamb and jamc are essential for vertebrate myocyte fusion. PLoS Biology. 9(12):e1001216
1 - 3 of 3
Show