ZFIN ID: ZDB-MRPHLNO-120125-5
Morpholino Name: MO1-lzts2a
Target: lzts2a (1)
Sequence:
5' - CATGGTGAACACCCGACCAGGACAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-lzts2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-lzts2a
Expressed Gene Anatomy Figures
bmp4 Fig. 5 from Li et al., 2011
chrd Fig. 4 from Li et al., 2011
cp Fig. 5 from Li et al., 2011
ctslb Fig. 4 from Li et al., 2011
dlx3b Fig. 4 from Li et al., 2011
foxd3 Fig. 4 from Li et al., 2011
gcga Fig. 5 from Li et al., 2011
ins Fig. 5 from Li et al., 2011
myl7 Fig. 5 from Li et al., 2011
myod1 Fig. 4 from Li et al., 2011
pcdh8 Fig. 4 from Li et al., 2011
pdx1 Fig. 5 from Li et al., 2011
shha Fig. 4 from Li et al., 2011
sox17 Fig. 4 from Li et al., 2011
sst Fig. 5 from Li et al., 2011
tbxta Fig. 4 from Li et al., 2011
PHENOTYPE
Phenotype resulting from MO1-lzts2a
Phenotype of all Fish created by or utilizing MO1-lzts2a
Genome Resources:
CITATIONS (1)