Morpholino
MO1-lpar2a
- ID
- ZDB-MRPHLNO-120123-7
- Name
- MO1-lpar2a
- Previous Names
- Target
- Sequence
-
5' - CCAGCCCTAAAACACAGGAAGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lpar2a
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| itga2b |
Fig. 5
from Lin et al., 2017 |
Phenotype
Phenotype resulting from MO1-lpar2a
from
Phenotype of all Fish created by or utilizing MO1-lpar2a
Citations
- Lin, K.H., Li, M.W., Chang, Y.C., Lin, Y.N., Ho, Y.H., Weng, W.C., Huang, C.J., Chang, B.E., Yao, C.L., Lee, H. (2017) Activation of Lysophosphatidic Acid Receptor 3 Inhibits Megakaryopoiesis in Human Hematopoietic Stem Cells and Zebrafish. Stem cells and development. 27(3):216-224
- Lin, K.H., Ho, Y.H., Chiang, J.C., Li, M.W., Lin, S.H., Chen, W.M., Chiang, C.L., Lin, Y.N., Yang, Y.J., Chen, C.N., Lu, J., Huang, C.J., Tigyi, G., Yao, C.L., Lee, H. (2016) Pharmacological activation of lysophosphatidic acid receptors regulates erythropoiesis. Scientific Reports. 6:27050
- Yukiura, H., Hama, K., Nakanaga, K., Tanaka, M., Asaoka, Y., Okudaira, S., Arima, N., Inoue, A., Hashimoto, T., Arai, H., Kawahara, A., Nishina, H., and Aoki, J. (2011) Autotaxin regulates vascular development via multiple lysophosphatidic acid (LPA) receptors in zebrafish. The Journal of biological chemistry. 286(51):43972-83
1 - 3 of 3
Show