Morpholino
MO2-nipblb
- ID
- ZDB-MRPHLNO-111201-2
- Name
- MO2-nipblb
- Previous Names
-
- nipbla-MO2 (1)
- Target
- Sequence
-
5' - TCGCTGCTCACTGATCCACCTTTAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nipblb
No data available
Phenotype
Phenotype resulting from MO2-nipblb
No data available
Phenotype of all Fish created by or utilizing MO2-nipblb
No data available
Citations
- Spreafico, M., Mangano, E., Mazzola, M., Consolandi, C., Bordoni, R., Battaglia, C., Bicciato, S., Marozzi, A., Pistocchi, A. (2020) The Genome-Wide Impact of Nipblb Loss-of-Function on Zebrafish Gene Expression. International Journal of Molecular Sciences. 21(24):
- Mazzola, M., Deflorian, G., Pezzotta, A., Ferrari, L., Fazio, G., Bresciani, E., Saitta, C., Ferrari, L., Fumagalli, M., Parma, M., Marasca, F., Bodega, B., Riva, P., Cotelli, F., Biondi, A., Marozzi, A., Cazzaniga, G., Pistocchi, A. (2019) NIPBL: a new player in myeloid cells differentiation. Haematologica. 104(7):1332-1341
- Muto, A., Ikeda, S., Lopez-Burks, M.E., Kikuchi, Y., Calof, A.L., Lander, A.D., Schilling, T.F. (2014) Nipbl and Mediator Cooperatively Regulate Gene Expression to Control Limb Development. PLoS Genetics. 10:e1004671
- Muto, A., Calof, A.L., Lander, A.D., and Schilling, T.F. (2011) Multifactorial Origins of Heart and Gut Defects in nipbl-Deficient Zebrafish, a Model of Cornelia de Lange Syndrome. PLoS Biology. 9(10):e1001181
1 - 4 of 4
Show